Thursday, October 31, 2019

Shakespeare othello Essay Example | Topics and Well Written Essays - 1250 words

Shakespeare othello - Essay Example He is a manipulator and vicious and desires for the demise of Othello by evoking jealousy in his mind against his wife Desdemona. Othello is a gentleman while Lago is a vicious character who succeeds in destroying the life of Othello and his wife through his malicious nature. Analysis of relationship of Othello with Lago The Othello is the hero of the play and Lago is villain and thus both share a contradicting relationship with each other. The relationship of both is of conflicting nature. The conflict is between two characters who had been warmest friends in the nearest time. Othello being the General and Lago being the trusted officer shared a lovable relationship with one another until the latter desires for promotion in his career and wanted to ruin Othello’s life completely.Until the conflict both were looked upon as individual with excellent ability and amicable character. Othello was known as the â€Å"noble moor† and Lago was his confident with honest character . The change in the attitude of Lago was sudden one and he immediately turned into a selfish man and mortal enemy of Othello. Lago treats Othello as a rival and wants promotion and take over the higher status in military. Othello has a â€Å"free and open mind† and this is utilized by Lago by conveying treacherous story of Desdemona to Othello. Yet Othello says that â€Å"She had eyes and Chose me â€Å".The rivalry rages between Lago and Othello, when the former hears that Cassius the friend of Desdemona had been promoted to lieutenant status which leaves him behind in professional hierarchy. Lago relationship with Othello turns bitter when he realizes that Othello has preferred Cassius for lieutenant role over him. He believes that Othello has disregarded rules of military and friendship, hence is only worth to be his enemy. The Othello had immense trust on Lago and was unaware of the bitterness growing in his mind against him. However, Lago’s start to saw seeds of hatred in the mind of Othello against Desdemona his beloved wife. The relationship verification of Othello and Lagos represents good versus bad. From the beginning of the play Lago is evil to Othello and as the play moves further he reveals his true colors. In the play, the character and intention of Lago remains same evil and Othello remains a puppet in his hand. Primary motive of Othello In the beginning of the play â€Å"Othello†, the central character Othello does not have any unjust motive. However as Lagos poisons his mind, he wishes to kill his wife due to the honor and pride he carried with his personality. He is definitely not much jealous as he is dishonored while hearing the disloyalty carried out by his beloved wife. The motive of honor encouraged him to kill his wife as he cried and enraged as an honored husband. Othello is a black man and he is being considered outcast by his wife’s father who was white .But Othello loved Desdemona deeply and the sexual jealousy brought forward by Lago hurts his ego, love and honor provokes him to kill Cassius and Desdemona. Primary motive of Lago The character Lago from the beginning of the play till the end is evil . He is a person who disregards moral beauty, ethics or nobleness. His primary motive is treacherous and wants to destroy Othello in every way. His eyes are on promotion and destruction of Othello’s. professional as well as personal life. He is wicked and is expert in performing acts

Tuesday, October 29, 2019

SLP 2 TUX 101 INFORMATION LITERACY AND ACADEMIC INTEGRITY Essay

SLP 2 TUX 101 INFORMATION LITERACY AND ACADEMIC INTEGRITY - Essay Example Unfortunately, owing to the dynamics in the contemporary society where both parents need to work in an effort to support each other in providing the demands of the family, there is limited time that parents spend with their children. Establishment of a balance amid work-family life becomes a difficult undertaking for many parents as most tend to focus on one and in most cases the work side. Caring for children and ensuring that all their demands are met, in most cases becomes the duty of the house helps, baby care centers and teachers (Gottschalg & Meier, 2005). The limited time that parents spent with their children exposes them to stress, and many develop depressive symptoms, which worsen the situation, as these parents increase the gap amid them and their children. Conversely, this is not the case for good parents, who have the capacity to balance their work and family life, and thereby manage to deal with the probable stress that emanates from the same. These parents engage with their children in all aspects, and regardless of being busy at work, they ensure that they learn how their children spent their day and whether they have completed their school work. These parents are always in close contact with teachers; house helps and baby care centers caregivers as they attempt to learn and comprehend the developments that their children are making. Another strategy that good parents adopt in order to eradicate stress and the development of depressive symptoms is by creating time to have fun with their children and spouses. Family outings help relieve stress and strengthen the bond amid parents and children are they interact from a friendly point of view, meaning children managed to express themselves easily, present their concerns and offer comm ents and insights on areas they believe need consideration, either at home or in school (Gottschalg &

Sunday, October 27, 2019

Genetic Variation of Taste Receptors

Genetic Variation of Taste Receptors Abstract: The people have different behaviour to choose the food, and there are many factors that affect the food choices. The best significant factor to choose the food is taste. Differences in taste perception of several taste modalities are associated to difference in the taste receptors. Polymorphisms of the genes that encoding these taste receptors may clarify these unpredictability in taste perception. Individual changes in the capability to identify bitter tasting compounds, such as phenylthiocarbamide (PTC) was a well-known example of this variability. This difference divided the people in two groups: tasters and non-tasters, and is because of in part to single nucleotide polymorphisms (SNP) of a bitter taste receptor gene, taste receptor, type 2 (TAS2R) 38. The experiment was designed to determine the PTC phenotype and genotype, the SNP at position 785 is of particular importance in genotyping. DNA was extracted from check cell by using Chelex technique and genotyped by using polymera se chain reaction (PCR) followed by restriction fragments length polymorphism (PCR-RFLP). A 2% of Agarose gel electrophoresed and stained with Ethidium Bromide to imagine the genotype pattern. The class was tasted PTC test paper to compare phenotype and genotype. The total was 108 students the genotype showed 21 taster (+/+), 51 was mild taster (+/-) and 36 was nontaster (-/-). The allele frequency was not statistically significantly differ from European population. Therefore, TAS2R38 genotype is a truer estimation of the extent of the influence of this single gene on taste perception of PTC in a genetically diverse population. Introduction: Taste perception is the most sensitive predictor of how much a food is pleasant and unpleasant. The people are different in the taste perception of sweet, bitter, sour, or salty tastes which could influence the dietary behaviour (2, 3, 4). The variations in the taste perception between the individuals may relate to a variation in the gene taste receptors (2). The gene family of the taste receptors are encoding from TAS1R and TAS2R. The bitter taste receptors are include the TAS2R38 and TAS2R550. While the umami and sweet taste receptors is the TAS1R. The sour taste receptors are the PKDIL3 and PKD2L1. The genetic variation in these receptors may causes to deferential favourites for some types of food. Phenylthiocarbamide (PTC) compounds is the example was more studied in the variation of the sensitivity of taste as the bitterness (2, 5). The TAS2R38 gene is one of the most studied from over twenty-five in bitter taste receptor gene (4).The TAS2R38 gene is responsible for the taste perception of PTC as more bitter and the other related compounds like 6-n-propylthiouracil (PROP) which both contain a group of thiourea (7.8). The variation in the gene TAS2R38 divided the individuals in two groups of thiourea tasters: tasters and non-tasters (4, 5). Phenylthiocarbamide (PTC) The variation in the taste perception of PTC rely on the genetic studies. In 1930s, difference in the ability to taste PTC was first finding by Arthur L. Fox in a laboratory accidental (6). When he was working in the laboratory and transferring PTC powder into a bottle. Some particles of PTC powder flew into the air and his colleague close to him C. R. Noller tasted the particles as bitter but Fox tasted nothing. Fox was make experiment to test a large number of individuals and he found the difference in their ability to taste PTC and he divided the people in two main groups’ tasters and non-tasters (1). Worldwide about 25% of population classified as ‘non-tasters’ and the remaining 75% as ‘tasters’ (1). In addition, Bartoshuk et al, in 1992, discovered that the ‘tasters’ varied in the perception of PTC/PROP in a bi-modal fashion, and they separated them into medium tasters and supertasters. The supertasters were very sensitive to PTC, pe rceiving them as more bitter, while the medium tasters may taste PTC and found it mild bitter. Besides, the spread of super, medium and non-tasters in the general population is roughly 25%, 50% and 25%, respectively (1). The PTC sensitivity believed to be inherited as a simple Mendelian trait with two alleles a dominant trait (T) for taster and recessive trait (t) for non-taster (9). Figure 1: shows the inheritance of PTC trait. PTC genotype TAS2R38 or PTC gene is located on chromosome 7q and consists of a single coding exon 1002 bp long, encoding 333 amino acids, 7-transmembrane domain G-protein-coupled receptor (2, 6). A number of SNPs have been identified within this gene, the three most common SNPs (>1% of the population has variants at a specific DNA sequence, considered an SNP and (4).Also, the PAV/PAV homozygotes are sensitive to PTC more than PAV/AVI heterozygotes while AVI/AVI homozygotes are fewer sensitive (4). The AVI haplotypes in the non-tester differ at 3 SNPs from the PAV haplotypes of the tasters (9). The aim of this practical: To focus on the TAS2R38 genotype and its link with the ability to taste PTC test paper. The SNP at position 785 is of specific concern in genotyping. Comparing the allele frequency detected in the class with those observed in European population subject in group 226 and Sub-Saharan African subject in group 224. Material and Methods: To determine the TAS2R38 (A262V) genotype by using the polymerase chain reaction (PCR) and restriction endonuclease digestion, Fnu4H1 enzyme. The procedure that has been done was as the following: Protocol of DNA Extraction from Cheek Cell (scrape or wash): First week take a 10 ml of water pour into mouth and swirl to release buccal cells and spit back contents into tube. Centrifuge the tube at 3000rpm for 3 minutes, carefully pour off supernatant and retain cell pellet. Added 350Â µl of 5% Chelex mix and then transfer the pelleted buccal cells to new (1.5ml) Eppendorf tube. The 5% Chelex to protects DNA breakdown under a high temperature. Added 4Â µl of proteinase K to the Eppendorf tube that contains buccal cells and 5% Chelex. Incubated the tube containing chelex/cells at 56Â °C for 30 minutes in the heating block, then briefly vortex the tube for 10 seconds after that centrifuge the tube at 3000rpm for 20 seconds. Incubated the tube ( chelex/cells) again in heating block at 98Â °C for 15 minutes, then vortex the tube for 10 seconds, after that centrifuge for 3minutes.Transferred the supernatant that above the chelex containing the buccal cell (DNA template) into the sterile 1.5ml Eppendorf tube and measured the DNA concentration by take 1Â µl of DNA into machine called nanodrop nucleic acid then kept at -20Â °C to preserve the DNA. Protocol of Phenyl Thiocarbanate(PTC) using PCR Reaction: Second week take a 43.5Â µl of master mix was already prepared in the PCR tube and transferred 6.5Â µl of DNA extraction. (Buccal cell DNA).Vortex and spin the tube to make the liquid contents to bottom of the tube. The total PCR tube reaction volume contain 50Â µl of mixtures were placed in the PCR machine and the thermal cycler conditions were: cycle of 94Â °C for 4 minutes. The 40 cycles of 55Â °C for 40 seconds, 72Â °C for 40 seconds and 94Â °C for 40 seconds .Then 1 cycle of 55Â °C for 5 minutes and at 72Â °C for 5 minutes. The sequence of Forward primer was 5’ AACTGGCAGAATAAAGATCTCAATTTAT3’ The sequence of the Reverse primer was 5’ AACACAAACCATCACCCCTATTTT 3’. Restriction Digestion (Fnu4HI): Last week transferred a 20 ÃŽ ¼l of the component mixture (PCR product) to a tube containing 10ÃŽ ¼l of the restriction endonuclease master. The tube was placed in into a 37Â °C heating block for two hours. Electrophoresis of PCR Products: A 30ml of 2% Agarose gel with 0.5Â µl/ml of ethidium bromide was loaded into the gel tank with adjusting the comb, the gel was kept 15 minutes to get stuck. After that the TBE buffer was loaded, covering the surface of the gel and the comb was removed. Take 12Â µl of PCR product undigested and digested into two different tubes added 3Â µl of DNA loading buffer mix and spin. Then, 10ÃŽ ¼l of PCR product/loading buffer was loaded into the well of 2% Agarose gel and 10ÃŽ ¼l of the ladder (100bp) was added in the last well. The gel electrophoresed at 90 volt for 45minutes, negatively charged (-ve) DNA moved toward the anode side (red). Last take gel photograph under UV trans-illumination. Taste tests: The PTC taste test paper was used to observe the capability to identify the bitterness of PTC and its relative with the TAS2R38 genotype. Statistical analysis: The data of the allele frequency for C785 and T785 observed in the class was compared to the allele frequency of European population subjects in group 226 and Sub-Saharan African subject in group 224 by using the Chi square test. The Chi square test was also used to investigate the association between the TAS2R38 genotype and phenotype. All statistical analyses were performed with Minitab data analysis software. References Feeney E. The impact of bitter perception and genotypic variation of TAS2R38 on food choice. Nutrition Bulletin. 2011; 36(1):20-33. Wooding S, Kim U, Bamshad M, Larsen J, Jorde L, Drayna D. Natural Selection and Molecular Evolution in PTC, a Bitter-Taste Receptor Gene. The American Journal of Human Genetics. 2004; 74(4):637-646. Chaudhari N, Roper S. The cell biology of taste. The Journal of Cell Biology. 2010; 191(2):429-429. Feeney E, OBrien S, Scannell A, Markey A, Gibney E. Genetic variation in taste perception: does it have a role in healthy eating? Proc Nutr Soc. 2010; 70(01):135-143. Lalueza-Fox C, Gigli E, de la Rasilla M, Fortea J, Rosas A. Bitter taste perception in Neanderthals through the analysis of the TAS2R38 gene. Biology Letters. 2009; 5(6):809-811. Kim U, Drayna D. Genetics of individual differences in bitter taste perception: lessons from the PTC gene. Clinical Genetics. 2004; 67(4):275-280. Dotson C, Shaw H, Mitchell B, Munger S, Steinle N. Variation in the gene TAS2R38 is associated with the eating behavior disinhibition in Old Order Amish women. Appetite. 2010; 54(1):93-99. Duffy V, Davidson A, Kidd J, Kidd K, Speed W, Pakstis A et al. Bitter Receptor Gene (TAS2R38), 6-n-Propylthiouracil (PROP) Bitterness and Alcohol Intake. Alcoholism: Clinical Experimental Research. 2004; 28(11):1629-1637. Merritt R, Bierwert L, Slatko B, Weiner M, Ingram J, Sciarra K et al. Tasting Phenylthiocarbamide (PTC): A New Integrative Genetics Lab with an Old Flavor. The American Biology Teacher. 2008; 70(5):e23-e28. Appendix

Friday, October 25, 2019

Analysis of Exodus 21-24 Essay -- essays research papers

Exodus 21-24 was definitely quite an instructive piece of literature. It was almost raw in its nature as a text or â€Å"book† but more of reading an excerpt from a piece of non-fiction most similar to an instruction manual of some sort that you get when you buy a dissembled bike or desk. Something like being enrolled in a police academy there was definite sense of a master-slave relationship in the air. It is like something never before seen in the Torah, these chapters showed a whole new YHWH. The YHWH who is feared like the school principal in an elementary school, not even mom and dad has come on so strong as to the dos and donts of living life. It seems as if YHWH was pushed to such a point where YHWH has no choice but intervene into the lives of his children, and set the rules for the pl... Analysis of Exodus 21-24 Essay -- essays research papers Exodus 21-24 was definitely quite an instructive piece of literature. It was almost raw in its nature as a text or â€Å"book† but more of reading an excerpt from a piece of non-fiction most similar to an instruction manual of some sort that you get when you buy a dissembled bike or desk. Something like being enrolled in a police academy there was definite sense of a master-slave relationship in the air. It is like something never before seen in the Torah, these chapters showed a whole new YHWH. The YHWH who is feared like the school principal in an elementary school, not even mom and dad has come on so strong as to the dos and donts of living life. It seems as if YHWH was pushed to such a point where YHWH has no choice but intervene into the lives of his children, and set the rules for the pl...

Thursday, October 24, 2019

American Red Cross- Basic History/Overview

Basic History/Overview: The American Red Cross is a non-profit organization supported solely off of financial donations and volunteers (community). Red Cross mission is to â€Å"provide relief to victims to victims of disasters and help people prevent, prepare for, and respond to emergencies. Red Cross was founded in 1881 by Clara Barton. Who was inspired by the Red Cross during the Prussian War. She first implemented what she had experience over in Europe in the U. S. during the Spanish American War in the 1898. The Red Cross joins more than 175 other national societies in providing aid to those in need across the world. The American Red Cross follows seven bylaws: humanity, impartiality, neutrality, independence, voluntary service, unity and universalities. Today the Red Cross have over a half million volunteers and 35,000 employees. The President of United States is the honorary chairman of the Red Cross and appoints the eight governs. In recent history American Red Cross had had its share of troubles which stated at the top of the executive tree and has seen several top resignations in the last decade. Ethical Issues/Key Facts: Red Cross main issues were around mismanagement of funds and donations to the Red Cross. †¢ In 2001 the American Red Cross ousted Elizabeth Dole, due to the fact of slow responses to 9-11 attacks. This started the Era of host of top executive failures and the doors kept revolving every few years with new presidents. Resignations varied anywhere from slow responses to mismanagement, lack of communication to misconduct with financial funds. †¢ After 9-11 the Red Cross had established a fund for those impacted by the incident. Red Cross received over $500 million dollars in pledges but only contributed a 1/3 of those funds to the 9-11 relief efforts. This sparked an ethical issue with ARC as far as monetary donation mismanagement. †¢ Hurricane Katrina sparked another issue for ARC. Again had ARC received over $2 billion dollars in donations and the public scrutinize as what was done with that money. These responses were the outcome of fraudulent and inefficient decisions. †¢ Red Cross downfalls continuously tend to be around monetary donations and the management of those funds. Questions: 1. I think the biggest problem are those at the top and how they are giving severance upon getting fired or resigning due to fraudulent activities of mismanagement of funds. This sends out a message to employees that it’s ok if you at the top of the chain and take money from us (ARC) we will still compensate you at the end. ARC needs to regain it trust in the community and communicate with the public as to how funds are distributed and the manner they are distributed in. 2. Some of the problems that ARC encountered with handling donations was that the monies that were donated where not allocated according to that particular disaster. Initially triggering this was 9-11, the public was outraged. The ARC would create funds, for example the Liberty fund for 9-11, however only gave one-third of it to relief efforts. People gave these donations with intentions that ARC would use the monies for the victims and their families. Another issues was the slow response time with Hurricane Katrina and it’s relief fund. . The ARC has many issues as listed in the case from executive compensation, employee misconduct, considering all stakeholders and slow response time. But I think the overall reasoning is once again at the top with poor decision making, improper leadership skills and inadequate use of donations. And I think in order for ARC to avoid these issues they need to â€Å"clean house† and train corporate managers and volunteers, not to mention dev elop a process for better communication through out organization in time of disaster needs. . I think that organizational structure has a great effect on ARC ethical issues, because it goes hand and hand with compensation and communication. I think the ARC can be revamped organizationally from the top to the bottom and this would eliminate the biggest ethical issue ARC has, which is mismanagement of donations. I also think that ARC has more Chiefs then Indians. Meaning that ARC has to many people at the top, with little leadership skills and poor business tactics.

Wednesday, October 23, 2019

A report on the serious failures of winterbourne view Essay

Winterbourne View, and the company Castle Beck Care LTD, failed to protect the individuals in their care from various types of abuse. They were not protected adequately from harm, risk and the own unsafe practices of the staff employed there. Staff at Winterbourne View had failed in their legal duty to notify the Quality Care Commission of serious incidents, including injuries to patients and occasions when they had gone missing. see more:identify reports into serious failures to protect individuals from abuse Ten essential standards, which the law requires providers to meet and Winterbourne View did not include; The managers did not ensure that major incidents were reported to the CQC as required. Planning and delivery of care did not meet people’s individual needs. They did not have robust systems to assess and monitor the quality of services. They did not identify and manage risks relating to the health, welfare and safety of patients. They had not responded to or considered complaints and views of people about the service. Investigations into the conduct of staff were not robust and had not safeguarded people. They did not take reasonable steps to identify the possibility of abuse and prevent it before it occurred. They did not respond appropriately to allegations of abuse. They did not have arrangements in place to protect the people against unlawful or excessive use of restraint. They did not operate effective recruitment procedures or take appropriate steps in relation to per sons who were not fit to work in care settings. They failed in their responsibilities to provide appropriate training and supervision to staff. The CQC report concluded that there were systemic failures in protecting people or to investigate allegations of abuse. Footage used in prosecutions showed member of staff repeatedly assaulting and harshly restraining patients under chairs, giving patients cold punishment showers, with one patient being left out in near zero temperatures and another having mouthwash poured in their eyes. Members of staff also pulled hair, poked people in the eyes, force fed medication and mocked patients to the extent one actually tried to escape through a second floor window to escape the torment. These are all massive failings of the staff and the company to provide a safe and secure environment for its service users. The CQC was also guilty of failing to investigate claims thoroughly. The case of Winterbourne View and the coverage that Panorama aired on television shocked the nation. Undoubtedly making a lot of people question the capability of the CQC as well as their local homes / services, where family members or friends may visit or live. The CQC held an internal inquiry and as a result there were many changes to various organisations. Winterbourne view inevitably closed and eleven people plead guilty to criminal offences of neglect or abuse. Six of which were jailed.

Tuesday, October 22, 2019

Nu wa essays

Nu wa essays In the beginning, the earth was nothing but a huge, dark, and empty piece of rock. Then an egg cracked, out came the God that separated the earth from heaven. From the "God" (Pan Ku), came lots of other deities that helped create earth as a whole. One of the deities was Nu Wa. Nu Wa's life was told in three stories; "Nu Wa Creates Humanity", "The Marriage of Nu Wa and Fu Xi", and "Nu Wa Mends the Sky." From the readings, Nu Wa plays different roles. All this roles leads to one responsibility, and that is to create and serve the people. In Chinese mythology, there were three versions of Nu Wa. The first version portrayed Nu Wa as the creator of humanity. It is said that there were no men when the sky and the earth were separated. It was Nu Wa who made men by molding yellow clay. "First she wet the earth. Then she squeezed it through her fingers. Then her hands moulded a little creature like herself, and when she placed it down beside the spring it began to laugh". (Yuan 5) She began to make more and more until the work was so tiring that her strength was not equal to it. So she dipped a rope into the mud and then lifted it. The mud that dripped from the rope also became man. Those made by molding yellow clay were rich and noble, while those made by lifting the rope were poor and low. This story tells how Nu Wa created human-beings and into for the continuonce of these human life, "She thought and thought and then she made some more men and women, and these she taught to love each other and raise children. And so it was that Nu Wa was the first match maker". (Yuan 5) She was also known as the goddess of marriage. 2.In ancient times, the four corners of the sky collapsed. The sky could not cover all the things under it, nor could the earth carry all the things on it. A great flood raced about and could not be stopped. Savage beasts devoured innocent people; vicious birds preyed on the ...

Monday, October 21, 2019

Denial of Service Attack, Bot and Botnet essays

Denial of Service Attack, Bot and Botnet essays Technology gets sophisticated as the years go by and by the same token, mans knowledge about the use and exploitation of technology increases. The Internet is probably one of mankinds greatest technological advances that contributed not only to the improvement of business and industry but the well-being of individuals as well. But the Internet is not without its flaws because since this technology is made by man, man could defeat it likewise. Throughout the decades, reports have inundated the mass media regarding attacks on the Web and the Internet. These attacks range from a simple Trojan sent via the email, spamming, proliferation of adware and spyware to massive assaults with the use of denial of service attacks (DOS), bots and botnets. It is not unusual for a DOS attack to be accompanied by bots and botnets nowadays. In previous years, the traditional means of DOS attack is via syn flood and UDP flood on network protocols (Vamosi, 2008). The present day DOS attacks have evolved, computer networks are hijacked to form so-called botnets that spray random packets of data in huge streams over the Internet. The deluge of data is meant to bring down Web sites and entire corporate networks. (Markoff, 2008) The attending bots and botnets are shortened terms for software robots for the former while an army of bots sent on the offensive becomes known as botnets (Puri, 2003). These are software programs developed by nefarious individuals that perform various automated tasks such as Website hijacking, information gathering, infecting vulnerable computers and networks or sending voluminous packets that overwhelm the intended target. Bots and botnets are also known as Web agents (because they are under the direction of a contro l or controller), Web crawlers or spiders (because they crawl throughout cyberspace looking for a prey or victim). Another interesting aspect is the prelude to a DOS atta...

Sunday, October 20, 2019

A Tale of Two Cities

Repetition is one of the linguistic devices of which Charles Dickens is very fond, and the novelist makes things easy for his readers by his constant repetitions, and his habitual phrases are remembered by readers who are not used to reading with close attention. Dickens’s stylistic use of repetition reaches its climax in A Tale of Two Cities (1859). Therefore, it is fruitful to deal with the language of Dickens, especially that of A Tale of Two Cities, from the point of view of repetition in order to explore his linguistic artistry with which the novelist, inheriting the language of the 18th century, improved upon the style of English prose. In fact, Dickens exploits various types of repetition, that is, repetition of sounds, morphemes, words, phrases, and sentences for various stylistic purposes, such as association, implication, irony, characterization, or verbal iconicity. However, in this paper I focus my attention on the repetitive use of words or phrases. â€Å"Dickens makes a broader use of the symbols and allegories that had long been dear to him. † (Monod) In reality, A Tale of Two Cities is full of repeated imagery and symbolic patterns. We hear again and again the footsteps and the rising storm; we see the drinking of wine and the staining blood. This novel achieves linguistic and stylistic contiguity through the repeated use of symbolic words like â€Å"footstep,† â€Å"echo,† and â€Å"wine,† â€Å"blood,† which are closely related to the subject matter of the novel. To put it another way, repetition of symbolic words fulfills an important function of promoting the thematic cohesion, by which the themes of this novel are brought to light. Here, I concentrate my attention on the repetition of the key word â€Å"wine,† and its related words â€Å"red† and â€Å"blood. These words often co-occur with one another, and convey additional and different meanings as well as their own specific meanings, in accordance with the scenes or contexts, especially between the English and the French scenes. The word â€Å"wine† occurs 120 times, â€Å"red† 56 times, and  "blood† 35 times in total. 11 The chapters of the novel are divided into three groups: English chapters, French chapters, and English-French chapters, depending on the location of the incidents in each chapter. It is often pointed out that the word â€Å"wine† and its related words â€Å"red† and â€Å"blood† frequently co-occur as an indication of the French Revolution’s slaughter and bloodshed. This does not reveal how the words create the symbolical imagery of the bleeding Revolution. Needless to say, the Revolution’s slaughter and bloodshed are not simply hinted at and represented through the repetition and co-occurrence of these three words, but the related words co-occurring with them in the same contexts contribute to creating the bloody imagery. The different or contrastive use of repeated words in the English and the French scenes in A Tale of Two Cities enables the reader to realize the author’s deliberate exploitation of words in terms of the subject matter, that is to say, contrast between the two cities. The repetition of â€Å"plane-tree† together with that of â€Å"pleasant† serves to create a favorable family atmosphere in the English scenes. In sharp contrast to this, in the French scenes, the words â€Å"fountain† and â€Å"fate† directly convey some of the dominant themes of the book: death, future life, fate, and resurrection. It seems that Dickens suggests the inevitable outbreak of the French Revolution and the characters’ sealed destinies through the verbal associations of such repetitive words arranged mainly in the French scenes. It is worth examining the repetitive use of â€Å"plane-tree† and â€Å"fountain† more closely and concretely. The words convey not only their own meanings but additional ones as well, for instance, foreshadowing. One example of the repeated use of â€Å"plane-tree† and â€Å"pleasant† in the English scenes can be observed in passage (8): 8) On this occasion, Miss Pross, responding to Ladybirds pleasant face and pleasant efforts to please her, unbent exceedingly; so the dinner was very pleasant, too. It was an oppressive day, and, after dinner, Lucie proposed that the wine should be carried out under the plane-tree, and they should sit there in the air. As everything turned upon her, and revolved about her, they went out under the plane-tree , and she carried the wine down for the special benefit of Mr. Lorry. She had installed herself, some time before, as Mr. Lorry’s cup-bearer; and while they sat under the plane-tree, talking, she kept his glass replenished. Mysterious backs and ends of houses peeped at them as they talked, and the plane-tree whispered to them in its own way above their heads. (Bk. II, Ch. 6) In the context of the passage above, Dr. Manette, Lucie, Mr. Lorry, and Miss Pross are in the courtyard after dinner. The repeated use of â€Å"plane-tree† and â€Å"pleasant† in close proximity serves to create a comfortable and cozy atmosphere of domestic peace. At the same time, however, I find the repetition of the word â€Å"wine. † As already mentioned, â€Å"wine† in the English scenes is associated with a serious development in the plot. Through the co-occurrence of â€Å"plane-tree† with â€Å"wine† we can sense an impending misfortune to threaten Lucie’s happy family life, even though the â€Å"plane-tree† itself carries a good connotation. In fact, in the scene which follows the passage above, all the characters who gather under the â€Å"plane-tree† hear the footsteps of the people in the street caught in the sudden storm, which seems to be indicative of the outbreak of the French Revolution. Additionally, the personification of the â€Å"plane-tree† and â€Å"houses† in the last sentence also serves as an ominous harbinger. As another example of the repeated use of the â€Å"plane-tree,† let me examine the following two passages. Passage (9) is observed at the very beginning, and passage (10) at the very end of Chapter 17 of Book II: (9) Never did the sun go down with a brighter glory on the quiet corner in Soho, than one memorable evening when the Doctor and his daughter sat under the plane-tree together. Never did the moon rise with a milder radiance over great London, than on that night when it found them still seated under the tree, and shone upon their faces through its leaves. Lucie was to be married to-morrow. She had reserved this last evening for her father, and they sat alone under the plane-tree. â€Å"You are happy, my dear father? † â€Å"Quite, my child. † (Bk. II, Ch. 17) (10) (Lucie sits by her father’s bedside for a while. ) She[Lucie] timidly laid her hand on his[Dr. Manette’s] dear breast, and put up a prayer that she might ever be as true to him as her love aspired to be, and as his sorrows deserved. Then, she withdrew her hand, and kissed his lips once more, and went away. So, the sunrise came, and the shadows of the leaves of the plane-tree moved upon his face, as softly as her lips had moved in praying for him. Bk. II, Ch. 17) The first passage appears in the context where Lucie and her father sit outside under the â€Å"plane-tree† the night before her wedding, and she reassures her father that her love for Darnay will not alter her love for him. The repetitive use of the â€Å"plane-tree† (and also the words â€Å"the tree† twice) along with the words indicative of light, â€Å"sun,† â€Å"brighter,† â€Å"moon,† â€Å"radiance,† or â€Å"shone† is closely related with the domestic happiness and hope that Lucie and her father feel. Furthermore, in passage (10), the word denoting light, â€Å"sunrise,† is also used. At the same time, however, the â€Å"plane-tree† co-occurs with the word â€Å"shadow,† which seems to carry an ominous implication for Dr. Manette’s future. In reality, in the following chapter, Chapter 18 of Book II, Dr. Manette has temporarily reverted to shoemaking because of the shock of Charles Darnay’s revelation, on the morning of his wedding to Lucie, of his identity as a member of the St Evremonde family. It can be said that the repeated use of the â€Å"plane-tree† itself symbolically suggests the Manettes’ domestic peace, co-occurring with the words significant of light. Yet, the change of words co-occurring with the â€Å"plane-tree,† that is to say, the new combination of â€Å"plane-tree† and â€Å"shadow,† implies the characters’ future fate in terms of foreshadowing. The foregoing arguments justify stating that Dickens deliberately exploits the technique of repetition with great artistry in order to individualize characters, to make creative use of conventional symbolic meanings, to prefigure future events, and to convey the main themes of the novel, such as fate, resurrection, and contrast, to the minds of the reader. The novelist’s use of repetition for the stylistic effects of emphasis and irony can also e found in his other novels. However, in A Tale of Two Cities, the repetitions of words and phrases are well organized and structurally used, and thus have the obvious function of creating a strong sense of unity in the structure of the novel. In a metaphorical sense, as various kinds of threads are woven to gether into texture, various kinds of repetition are skillfully interwoven into the story, and provide a strong sense of continuity and association within the novel. Such structural use of repetition is one of the linguistic peculiarities of A Tale of Two Cities.

Friday, October 18, 2019

Becoming Influential Essay Example | Topics and Well Written Essays - 1000 words

Becoming Influential - Essay Example Second, this could mean lower-cost and in-time PHC delivery to a broader population. Third, it will remove or at least lessen the legal barriers, caused by different state laws that hinder APNs to provide PHC (Hansen-Turton et al., 2010; Safriet, 2011). Lastly, it will give the nursing profession the due recognition that has long been denied of it. As such, I hope; my message will accomplish three things: First, it will convince our policy makers address the legal barrier that only they can resolve in order to make the Affordable Care Act truly realizable. Second, it will allay lingering fears among the general public regarding APNs’ competence and reliability as PHC providers. Lastly, it will challenge APNs to continue improving and loving their profession in order to achieve the respect and recognition they long sought for. Deciding on How to Share My Message Being an ordinary nurse, I don’t think that sending a personal letter to President Obama or anyone in the US C ongress will be influential. I believe that using the social media will be the best thing I can do to make my message most influential. I know that I am not the only one who believes that APNs should be given a wider role in the provision of PHC. Other APNs share the same belief as demonstrated by the lobbying of the American Nurses Association (Appleby, 2013). However, if lobbying for this will involve only the nursing profession, this may be perceived as self-serving. It is therefore important to get involved in this fight those who are at the receiving end of the USHCS. The time for this is right, as the recent study by the Association of American Medical Colleges' Center for Workforce Studies reveals that more people, especially the younger ones (aged 18-34 years old), prefer nurse practitioners or physician assistant (Kliff, 2013). Hence, I will appeal to these people to help APNs convince the President and the Congress to once and for all settle this legal barrier for APNs to become PHC providers. I know that the medical community, especially those who are used to the traditional physician-nurse hierarchy will speak against the competence of APNs to do this job. Yet more than this, I still believe that reason supported by empirical evidence will prove that APN-delivered care are actually at par with physician-delivered care in terms of safety and quality (O’Grady, 2008). My Message From this assignment I learned three sad realities. First, transforming the USHCS is truly difficult, because it is marred with vested interests from various stakeholders. Second, commitment and competence of APNs are not enough to ensure the provision of quality healthcare to a broader public due to legal barriers. Lastly, the important role the APNs consistently play in the delivery of safe and quality healthcare remains undervalued and unrecognized within and outside the medical community until today. This is despite the many empirical evidences affirming the equal c ompetence and reliability of APNs and despite their heightened qualifications, training, and experiences. These happen because nurses tend not to get involved

Thursday, October 17, 2019

Blame of Obesity on Fast Food Research Paper Example | Topics and Well Written Essays - 1250 words

Blame of Obesity on Fast Food - Research Paper Example The general consensus is that fast food is the major cause of the increasing levels of obesity. However, after conducting research on the respective notion, it can be stated that the blame of obesity cannot be totally blamed on the consumption of fast food since the nature of lifestyles plays a major role in the incremental weights among individuals. 2. Blame Fast Foods for Obesity? It has been witnessed in the recent history that the number of obese individuals is increasing more than ever. Evangelista, Ortiz, Soto and Urdapilleta stated that recognized organizations, such as World Health Organization, American Obesity Organization, acknowledge the fact that obesity has become a serious illness on a massive scale. Department of Health and Human Services revealed an interesting figure that obesity has increased by 60% in adults and has doubled in children since 1980. Center for Disease Control defined obesity as Body Mass Index (BMI) which is explained in terms of the height and weig ht of the individual. It is commonly witnessed that obese individuals try to earn money out of lawsuits against fast food organizations since they blame them for their obesity. The most obvious argument against such blame game is that no organization or individual forced them to eat anything; the excessive consumption of food has been done as a result of their own desires and wants. It can also be stated that individuals who eat fast food products but do not consume these products at an excessive rate maintain healthy lifestyles. Jaslow reported that fast food chains have been regulated to include the nutrition in all of their food items in New York, California and Seattle since 2008; other states and cities have also joined in with the passage of the years. The presence of labels can communicate the number of calories that are present in any item, thereby giving the consumer complete knowledge of what he is eating. The distribution of such information cannot hold the fast food chai ns liable for any instances of obesity. Rogers stated that lawyers often put the blame on fast food organizations by saying that poorly educated consumer segment cannot read the nutrition values on the fast food items and simply consume this type of affordable food, thereby moving towards obesity. Buchholz provided some relevant figures that negate the assumption that the lack of comprehension of nutrition on the fast food items increases obesity. He stated that around 53% of increase in obesity has been recorded in individuals with no high school education, whereas an alarming rate of 163% increase has been recorded among graduates who are very well able to understand the information on the fast food labels. Buchholz raised an important fact and stated that individuals have started eating between meals more than ever before; Americans used to eat less than one snack in a day in the late 1980s, whereas this figure reached to around 1.6 snacks every day by 1994. Further investigation of this figure shall reveal even more astonishing results for the past decade. This fact tends to shift the nature of the problem from eating heavy fast food meals, such as breakfast, lunch and dinner to munching between the meals that is known to be a major cause of unhealthy living. McKesson Health Solutions LLC and Gupta, Ray and Saha also agreed with this notion and stated that majority of the individuals admit to eating in between the meals and it is considered to be one of the major causes of obesity among individuals. It would not be wrong to

Wednesday, October 16, 2019

Sectionalism Essay Example | Topics and Well Written Essays - 750 words

Sectionalism - Essay Example They had plantations. These were large family farms that produced tobacco and cotton that relied on cheap labor in the form of slaves which was actually intensified as economic sectionalism grew stronger as well. Both North and South sections tried to have representatives in Congress for them to have the power to pass laws that would benefit their sections. Both wanted to have equal States rights and reasonable government tax on imports or exports. The West was also a section but was not part of the sectional conflict between North and South. However, the presence of the West aggravated their conflict as both sections fought to control the West. The people then moved westward and settled there, of course with the additional struggles faced with the first Indian settlers. They saw the west as an "open land", a free land where new opportunities awaited. As more people moved into the west, they realized how potential the land was which then showed the American development. The presence of fertile soil and flat lands attracted the farmers to Great Plains. The discovery of gold and animals rushed in miners and hunters. The people started to acknowledge that additional development to the land could provide them with lots of money. The settlers then slowly started to develop the land and made it prosperous that appealed to investors. The complexity of city life eventually became simple as people tried to embrace the new culture and economy of the West. There were traders, ranchers, miners and farmers that eventually boost the West economy. The opening of the West was indeed an avenue where people started to have hope, rights and duties in expanding and owning a free land. The opening of the West slowly neutralized the sectional conflict between the North and the South. Slavery, one of the four main issues starts to find its voice and freedom. Slavery was believed to be a sectional trait and since the west did not acknowledge this, slaves were not anymore half-free nor half-slave. They can also enjoy what a free man can. No racial discrimination. Black Americans can as well live and work freely with white Americans. Representation, second issue, the North and South as mentioned above seek representatives that will speak on their behalf and propose laws that will benefit their own sections. This is not the case with the West, as people continue to possess economic power, political power arises as well. As new settlers realized their independency in trading, managing and controlling of their new lands, it was also the beginning of intolerance to the government, the individualism of the people. We are to see here that economic opportunities slowly closed the gap caused by sectionalism; however, it also opened to individualism. Individualism in America has allowed a laxity in regard to governmental affairs which has rendered possible the spoils system and all the manifest evils that follow from the lack of a highly developed civic spirit (Turner). An individualism which made the government out of its function due to the immense success of the West economy that encouraged the people to rule the land expecting limited participation from the government. The individualism made them neglectful on their duties and responsibilities as citizens of America. Looking closely to it, the individualism of the West is as worse as sectionalism. Sectionalism only thinks of its own section while individualism only thinks