It s Come A Long Way From The First Draft - 1477 Words

This is the final draft of the essay. It’s come a long way from the first draft. The details are present and the thread is more clear. At least to me, the writer, it is. I’m proud of the elements I’ve chosen and of the way I’ve chosen to connect them. The use of freedom as a thread was difficult, yet the perfect challenge I needed. I love my thread, yet I’m not super confident in my imagery within the piece. I tried to incorporate more sensual imagery, but only accomplished visual imagery, a little bit of touch and smell. I’m proud of this piece merely because I managed to connect two things I absolutely love (nature and equine) with an issue we still face in this world, acceptance of others, ourselves and racism. Racism was displayed in the freedom taking of another man. Never did I think I would be able to connect these 4 completely different ideas in such a simple, yet complex way and absolutely love it. I’ve never been more excited about of a piece of writing and allowing people to read it than I am with this piece. There are so many things I’m proud of with this writing, but there are a few things I feel I’m weak in. I’m not quite sure everyone will agree with my thread being present throughout my entire essay, although I think it is, but maybe that’s because I wrote. I’m not quite sure if the repetition of the words ‘free’ and ‘freedom’ were effective or really necessary. And the imagery as I already said. I’m lacking the sense of taste as how do I represent taste withShow MoreRelatedI Am A Great Deal Of Anxiety Essay1145 Words   |  5 Pagesafter reading the three articles Donald M. Murray s Write Before Writing where he states the importance of pre-writing, Anne Lamott s Shitty First Drafts where she states it is normal to write a shitty first draft and Nancy Sommer s Revision Strategies of Student Writers and Experienced Adult Writers where she mentions revision and how its gone about with student writers and experienced adult writers. I now know writing is in fact a huge long process. Although I realize that what each one ofRead More Against Reinstating the Military Draft Essay1504 Words   |  7 Pages Against Reinstating the Military Draft On July 1, 1973, Congress chose to end the draft in favor of an All Volunteer Army. According to The Professional Bulletin of Army History, No. 27, the last man was drafted in December 1972 and reported for training in June 1973. Now, not only might the renewed military draft come back but also the age of compulsory service in the meat grinder might be extended from its former limit of 26 years up to 42 years of age. As Ken Adachi, the editor of Read MoreThe National Basketball Association Was Forever Changed1528 Words   |  7 PagesX was created to prevent high school players from entering the NBA when they were clearly not ready. It was also created to promote players at a collegiate level. â€Å"Article Ten† became known as the ‘One and Done Rule† because of its requirements. The rule was created to prepare high school athletes for the long nba season and all of the strain it puts on the body. College would help prepare these athletes by giving them a glimpse of the length of a long season. In Addition to the NBA would be presumedRead MoreProcess Essay930 Words   |  4 PagesWith each new football season comes a new fantast football season. New senses of hope and joy that this could be the year that you win it all start to set in. The preparation for the draft is as important as the draft itself. The first step to creating a successful fantasy team is to join a league well before the season. This is important because without joining a league it is impossible to make a winning team. Danny joined his league three weeks before his draft date, which will give him ampleRead MoreMuhammad Ali s Stand Against The Vietnam War1499 Words   |  6 Pagesbecause it showed that he was very courageous and also showed how much faith Ali had in the Nation of Islam to take a stand against not only the United States, but against the Vietnam War. The topic is important because it showed that if there s a will, there s a way and that you can take a stand against anything you want if you are determined enough, no matter the consequences. He stood up for himself and for his religion to show that the you can take a stand if you really believe that it is worth itRead MoreWhat Does Make You A Good Writer?945 Words   |  4 PagesShe was a leading researcher in the composing process which had her shaped and informed her writing. She mentioned that the writer must establish a â€Å"common ground† between themselves and the reader and we should have a target audience in mind. The first step is explaining how to step on closing that gap. It’s sometimes the critical difference such as age or background will be important. The reader knowledge about the topic, his or her attitude toward it. Most writers do more than just explaining theRead MoreCauses And Consequences Of Climate Change883 Words   |  4 PagesSecurity program, (Inaction on Climate Change: The Cost to Taxpayers). Looking at these reports, inaction on climate change has to stop and an action has to be taken. Additional reports from the Center for American Progress shows that after an analysis made, it is found that taxpayers spend nearly $136 billion total from fiscal year 2011 to fiscal year 2013 on disaster relief. This means an average of nearly $400 per household annually (Weiss Weidman, 2013). The report further states that these disastersRead MoreAsahi Breweries1638 Words   |  7 PagesDetail analyses and rationalities state in the following sections. Industry Analysis Japan s beer industry is concentrated and highly regulated. The industry was projected to grow by approximate 7.6% for 1988 as 1987 realized growth. There were mainly four kinds of beers: Dry, Draft, Lager, Melt. Consumer taste was graduating changing. Their preferences were switching from Lager beer to dry and draft beer. The government has tremendous power in this industry in terms of price and distributionRead MoreThe Discrimination Of Women And Women1291 Words   |  6 Pagespreference for male children, especially the first child. Eight days after the birth of a male child, a large party is held to celebrate the occasion. They are often held in enormous halls with large numbers of guests are invited. There is no equivalent ceremony for girls; however, recently some young Jewish couples have celebrated the birth of a daughter. Despite this, females are viewed by most as temporary residents who will eventually become a part of her husband s family. These practices are very discr iminatoryRead MoreWhy I Would Love : Mavs Moneyball?856 Words   |  4 Pagesa multitude of reasons why I would love to contribute to the site. Firstly, I ve been an avid reader for the better part of two years. I love the site and it s my go to place for all things Mavs, which is becoming harder and harder to find these days. Secondly, and more importantly, I absolutely love the NBA and the Mavs. My first true memory of the Mavs was Game 3 of the 2003 Western Conference Semi-Finals vs. the Kings. As I m sure you know, the Mavs were in what appeared to be an absolute

Seeing the World Through a Broken Heart Free Essays

The world is a pit of suffering and pain yet we see it not. All across the world, people are suffering from injustice, oppression, and from other afflictions caused by our very own brothers yet we feel not these things, least of all, know of them. A worse thing we have done is make ourselves be the very cause of their pain as if our indifference is not enough a mockery. We will write a custom essay sample on Seeing the World Through a Broken Heart or any similar topic only for you Order Now We do not know their plight, we cannot see their sufferings, we cannot feel their pain all because our hearts remain unbroken. We think the world is confined to the corners in which we move. We have learned to deafen our ears and harden our hearts to the grave injustice and oppression that our brothers across the continents go through everyday. We have downplayed their sufferings with cliches and punchlines we learned from self-help books and by doing so, our hearts do not turn to see their reality. And then, a single movie, carrying a powerful message, turns our worlds upside down. It breaks our hearts to millions of pieces and opens the eyes of our hearts. We witness the realities of this world and we get shaken. We start to stir up inside. We begin to ponder intently and thoughtfully about what the world goes through, we start to philosophize and discuss within ourselves who we are and what man is and what does man do. We start to wander through life’s realities and we always ask why. Our hearts have been broken and now see things in their most naked honest state, and so, it refuses to rest. What is a broken heart? A broken heart simply is an honest heart. It is a heart which is not blinded with fantasies but clearly sees reality as it is. It is a heart that looks at people through a clear glass and not through a rose-tinted window. It is a heart which does not deceive itself with promptings taught by the learned but contents itself only with what it has witnessed. Hotel Rwanda Hotel Rwanda pounded on my chest like a jackhammer with a deadline. It crushed my heart down to its basic components and forced me to adopt a whole new perspective about things. I never knew that a world such as that I have seen in the movie existed. I thought people from Africa suffered only from hunger. I never knew of a racial prejudice of that magnitude. I thought only Saddam Hussein was guilty of racial cleansing. How could have I been so base so as to be ignorant of what our brothers go through? I have never seen man so vicious. I have never seen man treat their brothers as â€Å"cockroaches† all because they are of a different race. My heart was shaken and the scenes remain vivid in my mind long after I have seen the movie. Often, in solitude, I contemplate on the movie and I ponder on why man such as the Hutus will do such a thing as they have done. Their skin color was the same. The only reason for the discrimination which I could gather from the movie is that the Tutsis were taller and had the more handsome features. And I ask: what is that?! Perhaps, it is envy. As I continue to ponder, I have come to believe that envy really is one viable reason for racial discrimination. The Great Holocaust, which executed hundreds of thousands of Jews, was inspired by envy. Aryanism is built upon envy over the chosen people of God. So perhaps too, the thing that happened in Hotel Rwanda was inspired by envy. The Hutus were envious of the Tutsis because the latter had better physical features. It is a shallow reason but it is enough to cause man to want to eliminate an entire tribe of people. Envy is the second of the seven deadly sins. And rightly so. The movie has proven how deadly it is. What does envy do to man? Among lovers it has caused a lot of broken relationships, unstable marriages, and even manslaughter. Stories of lovers shooting each other because of jealousy have passed by our ears millions of times. Among families, it has caused dissension. Families get broken up because of envy. Envy has caused brothers to hate their own brothers. It is noteworthy that the first murder committed was inspired by envy. The Bible account of Cain and Abel contains the story of the first murder where Cain killed his own brother, Abel, because of envy. Among friends, envy has caused contempt. Among classes and races of people, it has caused discrimination. How to cite Seeing the World Through a Broken Heart, Papers

Black Men and Public Space free essay sample

Brent Staples (b. 1951), the oldest of nine children, was born in Chester, Pennsylvania. His father was a truck driver who lost his job along with 40,000 other workers in the 1960s because of plant closings in the area. The family was reduced to poverty. Staples had never considered college until a college professor took an interest in him and encouraged him to apply to a program that recruited black students. He enrolled at Widener University (B. A. 1973), where he excelled and received a Danforth Fellowship for graduate study. He took a Ph. D. in behavioral psychology at the University of Chicago in 1977. From 1977 to 1981 he taught psychology at several colleges in Pennsylvania and Illinois, but a job as a report for the Chicago Sun-Times in 1982 and 1983 began his shift to journalism. He began writing for the New York Times in 1983 and has served on the editorial board of that newspaper, for which he writes opinion pieces on race, social problems, politics, and contemporary culture. In 1994, Staples published the autobiographical Parallel Time: Growing Up in Black and White, which won the Anisfield Wolff Book Award and in which â€Å"Black Men and Public Space† appears. The Term public space is just 30 years old, and definitions vary. One definition states that public spaces â€Å"protect the rights of user groups. They are accessible to all groups and provide for freedom of action but also for temporary claim and ownership. A public space can be a place to act more freely† (Steven Carr, quoted in â€Å"The Death of Public Space? † at http://www. columbia. edu/_gs228/writing/histps. htm). My first victim was a woman—white, well dressed, probably in her late twenties. I came upon her late one evening on a deserted street in Hyde Park, a relatively affluent neighborhood in an otherwise mean, impoverished section of Chicago. As I swung onto the avenue behind her, there seemed to be a discreet, uninflammatory distance between us. Not so. She cast back a worried glance. To her, the youngish black man—a broad six feet two inches with a beard and billowing hair, both hands shoved into the pockets of a bulky military jacket—seemed menacingly close. After a few more quick glimpses, she picked up her pace and was soon running in earnest. Within seconds, she disappeared into a cross street. That was more than a decade ago. I was twenty-two years old, a graduate student newly arrived at the University of Chicago. It was in the echo of that terrified woman’s footfalls that I first began to know the unwieldy inheritance I’d come into—the ability to alter public space in ugly ways. It was clear that she thought herself the quarry of a mugger, a rapist, or worse. Suffering a bout of insomnia, however, I was stalking sleep, not defenseless wayfarers. As a softy who is scarcely able to take a knife to a raw chicken—let alone hold one to a person’s throat—I was surprised, embarrassed, and dismayed all at once. Her flight made me feel like an accomplice in tyranny. It also made it clear that I was indistinguishable from the muggers who occasionally seeped into the area from the surrounding ghetto. That first encounter, and those that followed signified that a vast, unnerving gulf lay between nighttime pedestrians—particularly women—and me. And I soon gathered that being perceived as dangerous is a hazard in itself. I only needed to turn a corner into a dicey situation, or crowd some frightened, armed person in a foyer somewhere, or make an errant move after being pulled over by a policeman. Where fear and weapons meet—and they often do in urban America—there is always the possibility of death. In that first year, my first away from my hometown, I was to become thoroughly familiar with the language of fear. At dark, shadowy intersections, I could cross in front of a car stopped at a traffic light and elicit the thunk, thunk, thunk, thunk of the driver—black, white, male, or female—hammering down the door locks. On less traveled streets after dark, I grew accustomed to but never comfortable with people crossing to the other side of the street rather than pass me. Then there were the standard unpleasantries with policemen, doormen, bouncers, cabdrivers, and others whose business it is to screen out troublesome individuals before there is any nastiness. I moved to New York nearly two years ago and I have remained an avid night walker. In central Manhattan, the near-constant crowd cover minimizes tense one-on-one street encounters. Elsewhere—in SoHo, for example, where sidewalks are narrow and tightly spaced buildings shut out the sky—things can get very taut indeed. After dark, on the warrenlike streets of Brooklyn where I live, I often see women who fear the worst from me. They seem to have set their faces on neutral, and with their purse straps strung across their chests bandolier-style, they forge ahead as though bracing themselves against being tackled. I understand, of course, that the danger they perceive is not a hallucination. Women are particularly vulnerable to street violence, and young black males are drastically overrepresented among the perpetrators of that violence. Yet these truths are no solace against the kind of alienation that comes of being ever the suspect, a fearsome entity with whom pedestrians avoid making eye contact. It is not altogether clear to me how I reached the ripe old age of twenty-two without being conscious of the lethality nighttime pedestrians attributed to me. Perhaps it was because in Chester, Pennsylvania, the small, angry industrial town where I came of age in the 1960s, I was scarcely noticeable against a backdrop of gang warfare, street knifings, and murders. I grew up one of the good boys, had perhaps a half-dozen fistfights. In retrospect, my shyness of combat has clears sources. As a boy, I saw countless tough guys locked away; I have since buried several, too. They were babies, really—a teenage cousin, a brother of twenty-two, a childhood friend in his mid-twenties—all gone down in episodes of bravado played out in the streets. I came to doubt the virtues of intimidation early on. I chose, perhaps unconsciously, to remain a shadow—timid, but a survivor. The fearsomeness mistakenly attributed to me in public places often has a perilous flavor, the most frightening of these confusions occurred in the late 1970s and early 1980s, when I worked as a journalist in Chicago. One day, rushing into the office of a magazine I was writing for with a deadline story in hand, I was mistaken for a burglar. The office manager called security and, with an ad hoc posse, pursued me through the labyrinthine halls, nearly to my editor’s door. I had no way of proving who I was. I could only move briskly toward the company of someone who knew me. Another time I was on assignment for a local paper and killing time before an interview. I entered a jewelry store on the city’s affluent Near North Side. The proprietor excused herself and returned with an enormous red Doberman pinscher straining at the end of a leash. She stood, the dog extended toward me, silent to my questions, her eyes bulging nearly out of her head. I took a cursory look around, nodded, and bade her good night. Relatively speaking, however, I never fared as badly as another black male journalist. He went to nearby Waukegan, Illinois, a couple of summers ago to work on a story about a murderer who was born there. Mistaking the reporter for the killer, police officers hauled him from his car at gunpoint and but for his press credentials would probably have tried to book him. Such episodes are not uncommon, Black men trade tales like this all the time. Over the years, I learned to smother the rage I felt at so often being taken for a criminal. Not to do so would surely have led to madness. I now take precautions to make myself less threatening. I move about with care, particularly late in the evening. I give a wide berth to nervous people on subway platforms during the wee hours, particularly when I have exchanged business clothes for jeans. If I happen to be entering a building behind some people who appear skittish, I may walk by, letting them clear the lobby before I return, so as not to seem to be following them. I have been calm and extremely congenial on those rare occasions when I’ve been pulled over by the police. And on late-evening constitutionals I employ what has proved to be an excellent tension-reducing measure: I whistle melodies from Beethoven and Vivaldi and the more popular classical composers. Even steely New Yorkers hunching toward nighttime destinations seem to relax, and occasionally they even join in the tune. Virtually everybody seems to sense that a mugger wouldn’t be warbling bright, sunny selections from Vivaldi’s four seasons. It is my equivalent of the cowbell that hikers wear when they know they are in bear country.

On going on a journey free essay sample

While travelling through the countryside nature is company enough for the narrator and he wants to vegetate like the country and be part of it. A companion constantly reminds him of himself and place. Hazlitt goes out of his town to forget it and all its associations, his everyday-self and other people. But a companion, while talking, drops a hint or so reminding him of his everyday existence that he wants to leave behind. The soul of a journey is liberty, the liberty to think, to feel, to act and be what one likes without any obligation to conform to logic, expectations and manners. If a companion is present, the writer must act and conform to the demands of fellowship. Thus the friend stands in the way of his liberty. If he has a companion, good manners demand that they should talk to each other. The topics in such cases are often the stale and repeated ones. We will write a custom essay sample on On going on a journey or any similar topic specifically for you Do Not WasteYour Time HIRE WRITER Only 13.90 / page The need to talk to the companion will not allow him to do as he pleases. He would probably like to run, laugh, sing and jump. He would like to plunge into his past, long forgotten things and muse over them. He cannot indulge in the musings at ease. He would probably remain silent for long time musing and talk for a while. Such a half-hearted fellowship is one that the writer would better not have. The writer does not find any wisdom in feeling and talking at the same time. He faces the constant necessity to translate his feelings into words and to communicate them. The pleasure of feeling aroused by a beautiful scene or an object turns into a toil. The mind registers an impression deeply if it gets sufficient time to muse over a thing. Interrupted by the constant need to communicate, the things seen cannot leave a deep impression in the mind. Therefore the writer prefers to use the synthetical method in a journey, not the analytical. To see, feel things and store the impressions and ideas in the mind to analyze them later. Even if one is ready and willing to communicate one’s feelings, the companion may not have the necessary sensibility to share the feelings. If one talks about the smell from a bean field, the friend probably does not have the sharp sense of smell. He may be too short-sighted to see a distant object that one likes to talk about. The writer thinks that certain communications cannot be communicated at all. The effect of the very air of the place or a patch of cloud has on the mind cannot probably be explained. Yet he will try to account for it and communicate it to his friend. Such an impossible task may produce ill humour. Moreover a view or a scene may bring into the mind a certain associations, too delicate and refined to be communicated. With a companion at hand, a traveller has to unravel the mystery of his being and his feelings in beautiful words. Poets like Samuel Taylor Coleridge who have the fine poetic madness in them, can clothe their thoughts and feelings in beautiful words spontaneously, immediately after seeing a beautiful object. But Hazlitt does not have the ability to translate a feeling at once into beautiful words like Coleridge. Hazlitt would like to enter an inn in the village or a town all by himself. He would like to indulge in idle diversions, to think about his food and to get the smell of food coming out of the kitchen. If at all he has to have a companion in an inn, he prefers to have a stranger. With a stranger we are not under the constant need of fellowship. Even if we do not talk the stranger does not mind. Moreover the stranger will not know the writer. To him the writer is not a man of fixed identity with a definite expected character and nature. So the writer can easily assume any imagery character and personality. To the usual acquaintances a man has a fixed personality with a certain expected character. Before strangers, the writer can easily forget his usual being. Hazlitt likes to be alone on a journey, but with a few expectations. He would not object to having a friend or a party with him while visiting a historical ruin or a picture gallery like Stonehenge, Oxford, Athens or Rome. These are intelligible matters or matters that can be intellectually analyzed. One can talk about them. But the feelings aroused by a landscape or a view of nature are pure feelings that are difficult to analyze and communicate. Hazlitt would also like to have a companion while travelling to a foreign country. He feels so probably because an Englishman has an antipathy towards foreign manners and language. So he would like to talk to a companion and share his feelings with a friend to feel at ease in a foreign country amoung foreigners. Hazlitt would like to have a friend to talk to when he is before such mighty things like the desert of Arabia or the Pyramids of Egypt. One feels lost and lonely, as if cut off from society. So to overcome that feeling of isolation Hazlitt wants some fellowship and support from a fellow man.

Pavlov therory essays

Pavlov therory essays A commonly heard word within psychology is conditioning, where does it come from and what does it mean? Conditioning is simply a form of learning, specifically learning through association. Conditioning is used in many experiments as I will discuss later. Classical conditioning was stumbled upon by accident by Russian physiologist Ivan Pavlov. After he earned his medical degree in 1882 he spent many years studying the digestive system of many animals. By the year 1904 Pavlov had won the Nobel Prize for all of his research in that field. While studying the digestive system he had a dog strapped down with a harness, and fed it different types of food. While doing this he had a tube that was surgically put into their cheeks to measure the amount of saliva the dog had released. After repeating this process a couple of times he ran into what he called a problem, the dog would salivate at just the site of the food, and eventually the dish the food came in and even the sound of footsteps walking towards him. Pavlov, trying to get around this problem tried to sneak up on the dog, but to no avail. Later Pavlov realized he stumbled upon a form of learning now known as classical conditioning, and devoted the rest of his life to studying it. To study his new, so called problem he had to have a system set up in which he would feed the dog. Often he used a dry meat powder, this powder would automatically cause the dog to salivate. The automatic response to food is known as the unconditioned response, it is known as this because the response does not have to be taught, hence the term unconditioned. The food in this example is known as the unconditioned stimulus, what stimulated the salivation was the food. After Pavlov took notice of all of this he wanted to see if the dog can be conditioned (trained) to respond to an unnatural stimulus, unnatural, being one that would not have an automatic reaction to the stimulus. To exa...

Biography of the German Explorer Carl Peters

Biography of the German Explorer Carl Peters Carl Peters was a German explorer, journalist and philosopher, instrumental in the founding of German East Africa and helped create the European Scramble for Africa. Despite being vilified for cruelty to Africans and removed from office, he was later praised by Kaiser Wilhelm II and was considered a German hero by Hitler. Date of birth: 27 September 1856, Neuhaus an der Elbe (New House on the Elbe), Hanover GermanyDate of death: 10 September 1918 Bad Harzburg, Germany An Early Life: Carl Peters was born the son of a minister on 27 September 1856. He attended the local monastery school in Ilfeld until 1876 and then attended college in Goettingen, Tà ¼bingen, and Berlin where he studied history, philosophy, and law. His college time was financed by scholarships and through early successes in journalism and writing. In 1879 he left Berlin University with a degree in history. The following year, abandoning a career in law, he left for London where he stayed with a wealthy uncle. Society for German Colonisation: During his four years in London, Carl Peters studied British history and investigated its colonial policies and philosophy. Returning to Berlin after his uncles suicide in 1884, he helped establish the Society for German Colonisation [Gesellschaft fà ¼r Deutsche Kolonisation]. Hopes For a German Colony in Africa: Towards the end of 1884 Peters traveled to East Africa to obtain treaties with local chiefs. Although unsanctioned by the German government, Peters felt confident that his endeavors would lead to a new German colony in Africa. Landing on the coast at Bagamoyo just across from Zanzibar (in what is now Tanzania) on 4 November 1884, Peters and his colleagues traveled for just six weeks persuading both Arab and African chiefs to sign away exclusive rights to land and trade routes. One typical agreement, the Treaty of Eternal Friendship, had Sultan Mangungu of Msovero, Usagara, offering his territory with all its civil and public privileges to Dr Karl Peters as the representative of the Society for German Colonisation for the exclusive and universal utilization of German colonization. German Protectorate in East Africa: Returning to Germany, Peters set about consolidating his African successes. On 17 February 1885 Peters received an imperial charter from the German government and on 27 February, after the conclusion of the Berlin West African Conference, the German Chancellor Bismarck announced the creation of a German protectorate in East Africa. The German East-African Society [Deutsch Osta-Afrikanischen Gesellschaft] was created in April and Carl Peters was declared its chairman. Initially a 18 kilometre costal strip was recognized as still belonging to Zanzibar. But in 1887 Carl Peters returned to Zanzibar to obtain the right to collect duties - the lease was ratified on 28 April 1888. Two years later the strip of land was purchased from the Sultan of Zanzibar for  £200,000. With area of almost 900 000 square kilometres, German East Africa almost doubled the land held by the German Reich. Searching for Emin Pasha: In 1889 Carl Peters returned to Germany from East Africa, giving up his position as chairman. In response to Henry Stanleys expedition to rescue Emin Pasha, a German explorer and governor of Egyptian Equatorial Sudan who was reputed to be trapped in his province by Mahdist enemies, Peters announced his intention to beat Stanley to the prize. Having raised 225,000 marks, Peters and his party depart from Berlin in February. Competition with Britain for Land: Both trips were actually attempts to claim more land (and gain access to the upper Nile) for their respective masters: Stanley working for King Leopold of Belgium (and the Congo), Peters for Germany. One year after departure, having reached the Wasoga on the Victoria Nile (between Lake Victoria and Lake Albert) he was handed a letter from Stanley: Emin Pasha had already been rescued. Peters, unaware of a treaty ceding Uganda to Britain, continued north to make a treaty with the king Mwanga. The Man With Blood on His Hands: The Heligoland Treaty (ratified on 1 July 1890) set German and British spheres of influence in East Africa, Britain to have Zanzibar and the mainland opposite and towards the north, Germany to have the mainland south of Zanzibar. (The treaty is named for an Island off the Elba estuary in Germany which was transferred from British to German control.) In addition, Germany gained Mount Kilimanjaro, part of the disputed territories - Queen Victoria wanted her grandson, the German Kaiser, to have a mountain in Africa. In 1891 Carl Peters was made the commissioner to renamed protectorate of German East Africa, based in a newly created station near Kilimanjaro. By 1895 rumors reached Germany of cruel and unusual treatment of Africans by Peters (he is known in Africa as Milkono wa Damu - the Man with Blood on his hands) and he is recalled from German East Africa to Berlin. A judicial hearing is undertaken the following year, during which Peters relocates to London. In 1897 Peters is officially condemned for his violent attacks on African natives and is dismissed from government service. The judgement is severely criticized by the German press. In London Peters set up an independent company, the Dr Carl Peters Exploration Company, which funded several trips to German East Africa and to British territory around the Zambezi River. His adventures formed the basis of his book Im Goldland des Altertums (The Eldorado of the Ancients) in which he describes the region as being the fabled lands of Ophir. In 1909 Carl Peters married Thea Herbers and, having been exonerated by the German emperor Wilhelm II and granted a state pension, he returned to Germany on the eve of the First World War. Having published a handful of books on Africa Peters retired to Bad Harzburg, where on 10 September 1918 he died. During World War II, Adolf Hitler referred to Peters as a German hero and his collected works were re-published in three volumes.

Ethnocentrism Essay Example | Topics and Well Written Essays - 500 words - 1

Ethnocentrism - Essay Example hropologists agree, likes to make premature judgments about other cultures and consequently brings false assumptions into his dealings with other cultural groups. In international relations, as a result, innumerable conflicts have broken out in the name of ethnocentrism. Constructive resolution of such conflicts between social groups have proven intractable in most cases because of one group’s lack of understanding of the other’s cultural uniqueness. One of the earlier names of ethnocentrism is colonialism, in which one culture sought to â€Å"civilize† and â€Å"develop† another. As was often the case, the social group placed under the gun of colonialism had its own concept of â€Å"civilization† and â€Å"development† which was quite different. Conflicts inevitably occurred. â€Å"When people are denied the legitimacy of their own life goal,† notes anthropologist Ken Barger, â€Å"they turn to radical means outside accepted practice.† Thus, we witnessed the bloody revolutions in colonized nations against colonizers that eventually led to global de-colonization starting in the 1950s, to coincide with the growth and acceptance of the United Nations. Colonialism is actually one of the three extreme forms of ethnocentrism, the other two being racism and ethnic cleansing. The latter gave rise to the most notorious ethnocentric of all time, Hitler, who sought to annihilate the Jews in favor of the â€Å"pure’ Aryan race and in the process triggered World War I. The belief that any culture represents the pinnacle of human achievement, which certainly possessed Hitler, is cultural arrogance of the worst form, a gross misreading of history and anthropology. Evidence of the evils wrought by ethnocentrism is all over the globe in modern times. On top of this is the mutual ethnocentric attitude between the Islamic world and the capitalist societies represented by the United States which now more than ever threatens to divide the planet. The Islamic societies

What would you consider to be distinctive features of US approaches to Essay

What would you consider to be distinctive features of US approaches to HRM, and what extent do you think these would be exportable to the rest of the world - Essay Example al nuisance, more so when the economy is not that encouraging boosting trade ties between stakeholders, different organizations and so on and so forth. The corporate strategy plays a significant role at building a bridge between the company’s inner policies and the undertakings it has with the various stakeholders, who could be from the human resources management settings. (Korzeniowski, 2001) Human resources management in a developing country like India is much different than it is in a developed nation – United States for example. The differences arise in the way works are done as well as the manner in which people are held accountable and answerable for their respective tasks and job natures. Conducting business within USA is also different because it has a distinct culture of its own. Its people speak different languages, adapt to a number of traditions and have family make-ups of a completely distinct proposition. (Enright, 2000) Human resources management in different venues of the world is a difficult yet interesting proposition. What might be hailed as a suitable entity in one location could be judged as a sheer loser in another country or business marketplace for that matter. Thus human resources management takes care of the social and cultural concepts of the place. Thus it is pertinent to note that different business markets of the world have differences in them nonetheless. A developing country has a developing market and the business which is widespread in its environs is something that has just started or remained within the realms of its exploration. On the other hand, a developed business environment – that of the US for instance, sustains growth and the profitability from the business standpoint is a part and parcel thing. Misunderstandings are an understood notion in a society such as of USA where people adhered to an agreed and applied culture but did not actually know the facets of the followed traditions and the cultural history. It was

Peace Project Essay Example for Free

Peace Project Essay Writing is more than speech written down. Because of its permanence and its one-way nature, writing is more elaborate and orderly than speech. We can write more carefully and more accurately than we can speak. This is why educating children with writing is very vital so that they will trained to pen down their thoughts clearly. Through WordWeavers project, children are taught to write on a wide variety of topics and explore many different writing styles. They are also encouraged to comment on the writing of other participants and write about the writing process itself, telling about what type of writing they enjoy most, how they get their ideas, what they do when they are having trouble, etc. Although WordWeavers is a simple project, children will be basically trained in the process of writing itself where they will be exposed to weaving their own ideas to words and putting it all in paper. Peace Project (Serenity Quest) http://kidspace. kidlink. org/kidspace/start. cfm? HoldNode=8131HoldNav=614 Currently, as the world changes its order, many nations are still at war. One example of this is what happened in Israel and Lebanon. As reflective, competent, and concerned citizens of the 21st century, we are constantly confronted with questions about war and peace. In answering, citizens will be forced to balance immediate national interests with those of the world as a whole. With the Peace Project, students will be enjoined to comment about issues of violence, race, war and peace. Irrespective of their curriculum and the country, all educators will develop problem solving and communication skills for the children to live successfully in the Digital Age. This project directly focuses on these skills as the children discuss the social problems of violence in the neighborhood. They are also encouraged to develop strategies to cope with violence and to identify methods of inducing peace in their neighborhoods. After this, they will be motivated to read and write for themselves their own realizations about the issues tackled. Peace Project is subtle initial step for children to spark peace within their surrounding and this will make them realize that how better would the world become if everyone will try to respect and understand each other. e-Pals Safe Browser http://safebrowser. epals. com/en/ As the Internet becomes more and more becoming a vital source of information, it is essential that children learn to use it. However, dangers about pornography and inappropriate information could be derived from it. This is why the ePALS Classroom Exchange, Inc. , a school-safe email and eMentoring technology for K-12, has come up unique child-safe web browser project to surf safe and educational websites only. The ePALS Safe Browser allows parents and teachers to pre-determine the websites that their child or students are allowed to visit, creating a fully contained and protected environment. The ePALS Safe Browser offers a level of protection and does not allow linkage to outside websites: Parents and school administrators create a totally safe and controlled online environment. This project is helpful so that children would be able to experience how to use the Internet. They would be able to read only useful and helpful information that will target to increase their knowledge. Square of Life http://www. k12science. org/curriculum/squareproj/index. htm Learning about the environment is helpful for children to understand the concepts about conservation and preservation of nature. One exemplary project is called the Square of Life: Studies in Local and Global Environments Project. This is an Internet-based collaborative project in which students will investigate their local environment and share that information with other students from around the country and the world. In this project, the participants will identify living and non-living things in their school yards, share their findings with other participating classes, look for similarities and differences in the reported data and prepare a their own final report or presentation based on their findings. The fun part of this project will be the field trips where children will be able to explore biology and nature with their own eyes. The experience derived will be the basis for their thoughts and discussions.

Contemporary Issues in Cognitive Developmental Psychology :: Papers

Contemporary Issues in Cognitive Developmental Psychology The stage in which a child learns is very important in psychology. Piaget, Vygotsky, and Bruner are the most popular psychologists who have contributed to developmental learning. The issue still among psychologists today is the debate on teaching, and how children should be taught. There is the, "talk and chalk" method where the teacher teaches the whole class interactively and the children can participate when asked to. Piaget believed in student centred learning and not group learning. The advantage of this method of teaching is that they are all going up a level at the same time; there might be a few that fail to follow but the teacher can push them. Children can also start to interact with each other and get to know other people in their classroom. This could also reduce prejudice at a young age. If they work as a group they also learn as a group, but the downside of this is they may lose their sense of individuality. And as a group they may feel as, "one." If they were to do a practical there would be one child who would be the leader, which would not benefit to the other children. The other method of teaching is the individual/ group method. This is where Piaget's individual learning programme enters. Vygotsky's spiral curriculum would be useful in this method since it opens complex ideas so that they can be presented at simplified levels. Each student should find their zone of actual development and then the teacher should be the outer circle so they can go to their zone of proximal development. The disadvantage of this is the cost of student centred learning. At the moment we have whole class teaching and there are the ups and downs of that but if the individual learning took place it will improve due to the individuals needs being noticed and processed. Individual learning can also be structured by scaffolding so the child's attempt to understand new ideas will be done with even more

Develop positive relationships Essay

You Assessor will observe these Standards in your place of work. Why is having a positive relationship with children and young people important 1.1 Working with children requires us to build relationships with them quickly, but also in ways that are professional. Building and maintaining positive relationships- the quality of relationships that we have with children and young people has a huge effect on the way in which we can work with them. Positive relationships with children and young people is important because when children feel comfortable with us they can separate more easily from their parents, children are more likely to participate in the play and learning activities if they are secure emotionally, when children have strong relationships, they are less likely to show unwanted behaviour as we can recognise and meet their needs, childrens language develops more quickly because they feel comfortable talking to us, practitioners can plan more accurately as they understand childrens development needs and know their interests, practitioners are able to respond to children more effectively because they can recognise thei r expressions and emotions. Explain how you build and maintain positive relationships with children and young people 1.1 Communicating effectively- one of the most important aspects of building a relationship is to find ways of communicating effectively. Communication is not just about words it is also about our facial expressions, body language and gestures. Identifying and sorting out conflicts and disagreements- groups of children, like adults will have disagreements. As children become older these can become more serious and are not simply squabbles. In order for children and young people to trust us, it is important that we can identify difficulties and help them wherever possible to find ways through them. It is important that children and young people perceive our way of doing this as fair. Being consistent and fair- children and young people rely on us. This means that it is essential day after day we are consistent. Consistency means not just keeping behavioural boundaries in place, but also making sure that we do not have significant mood swings, for example, one day been excitable and fu nny and the next being quiet and withdrawn. Children also need to know that we will be fair with them. We will listen to what they have to say before jumping to conclusions and we will try to make sure that their needs are taking into consideration. Fairness is also  something that adults need as well. Parents will want to see that the way their family is being treated is comparable with others, while staff members need to feel that their work place is a fair one where everyone is expected to pull their weight. Showing respect and courtesy- children and young people will need to receive respect and courtesy from us in order that they can extend these skills to others. From the earliest age we should be using markers of respect in English such as saying please and thank you. We should always speak to children and young people using voice tones that are warm and courteous. Principles of relationship building . communicating effectively . identifying and sorting out conflicts and disagreements . being consistent and fair . showing respect and courtesy . valuing and respecting individuals . keeping promises and honouring commitments . monitoring impact of own behaviour on others . keeping confidentiality as appropriate . recognisi ng and responding appropriately to the power base underpinning relationships Babies for instance, they need comfort and bonding time with their key person. Spending time with a baby not only playing, but simple gestures as cuddling, rocking, soothing and singing. Also, when you are changing their nappy or feeding them. This time is precious as you have direct contact with the child. You can talk and show affection by making faces, by touch and laughing. It is important to give them eye contact. This time is sometimes more important than planned activities. Toddlers also need the same comfort of cuddles and taking time to just talk to them and again give them eye contact and special moments that make them feel individual which can be sometimes lost in a setting with more than one child. It is important to be consistent with routines and discipline so that a child can feel safe and secure. Also, to keep promises. If a child is promised that tomorrow or later that day we can read a special book that they have bought with them, then we must do so. Explain why it is important to have a positive relationship with the people involved in the care of children and young people 2.1 The professional and positive relationships we develop will ensure that good communication is possible in order to support the needs of children and their families. Where we do not have strong relationships, there is a danger that information may be passed inaccurately or that it is withheld because we may not be not trusted. This Has to be taken seriously as, over the past few year, some child deaths  have occurred because people caring for children have not worked properly together where parents are concerned, it is essential that we build positive relationships so that we can work closely together to benefit there child in a variety of ways. This should include settling the child in, sharing development information and also learning about childrens interests. Benefits of positive relationships .information can be shared quickly between adults .children are given consistent care .childrens interests and needs are identify .plans for childrens care and education are more effective . childrens welfare can be properly monitored . skills and ideas can be shared Evaluate your strengths and effectiveness with building relationships with children and young people. 1.3 The great thing about children and young people is they are all different. This means that we need to adapt the way in which we approach and communicate with them according to their age/stage of development needs and personality. Not so long ago some adults working with two children of exactly the same age would have expected them to respond in similar ways, and a child who did not respond as the adult expected might have been seen as shy, sullen or even difficult. Today it is appreciated that it is more appropriate for the adults to change the way in which they work, rather than condemn the child. An important starting point is therefor to consider how effective our relationships with children and young people are. Interestingly some tell-tale indicators of the strength of our relationships with children and young people can be seen through some everyday activities.

Public Relations Professionals and Educators

As Michael Winkleman described, public relations professionals and educators are currently engaged in a vigorous discussion of the role of ethics within the profession and the means by which ethics can be taught to both public relations students and professionals. According to Winkleman, the rise in concern over ethical issues can be traced to the reaction of the profession to events in the 1980s, which included high-profile instances of insider-trading and covert government foreign policy activities. In addition, the ethical debate is thriving because corporations have realized that they have to pay more attention to social demands and be more responsive to â€Å"stakeholders. † This realization has paralleled the move from theoretical ethics to applied ethics. Winkleman's conclusion is that ethics are crucial for public relations because they will benefit the profession and the companies for which the public relations work. Ultimately, ethics are good for business. In addition, there is empirical evidence suggesting that public relations professionals basing their decision-making and recommendations to management on ethical principles and social responsibility are more likely to have a greater role in management decisions and activities. The result of this concern over ethics in the public relations field has resulted in a vigorous debate over the pros and cons of a universal ethics code. Many writers agree, despite their differences, that not only does ethical decision-making give public relations professionals more opportunities to participate in the management function, but it also assists the development of public relations as a â€Å"profession. † Ethics and social responsibility are also vital issues in public relations because public relations facilitates communication among the company and its many publics, including society at large. As Pratt notes, there are three main points that result from all the empirical research conducted on practitioner ethics. First, â€Å"they underscore the notion that ethics is an important issue practitioners confront. † Second, â€Å"they suggest that practitioners cannot ignore public (and industry wide) evaluation of their professional ethics and that corporate managements need to continually institute ethics in the workplace. † Third, â€Å"they suggest that older practitioners can help set an organization's ethical tone. However, as will be discussed later, Donald K. Wright convincingly argues that ethical behavior is performed by practitioners primarily out of a sense of personal morality and wanting to be respected by his/her various publics, rather than as a result of vague, codified ethical guidelines. Perhaps, what makes the subject of ethics difficult to address from a pragmatic point of view within public relations is the paucity of empirical research and theoretical writing on public relations ethics. This is surprising given that 75% of the educators at a recent AEJMC conference stated that ethics was an important aspect of their teaching and that PRSA members, in a questionnaire, voted the Code of Professional Standards to be the most important member benefit. Many educators are currently urging public relations practitioners to adopt a universal code of ethics. The interest in this topic is evidenced by the special issue of Public Relations Review from the spring of 1993 entirely devoted to the subject of ethics. Naturally, the problem will arise in developing a code that can specifically address each specific morally problematic situation. Possibly due to this problem, some of the writers addressing this issue have been somewhat non- specific in delineating the actual components of an ethical code. However, others such as Hunt and Tirpok have suggested the framework for a code and the strategy for its employment. Kruckeberg believes that increased globalized trade has hastened the need for an international (universal) code of ethics for communicators. In analyzing the functions of transnational corporations, he describes four social benefits these companies provide to Third World countries: â€Å"(1) development of human resources through employment, training, and indigenization†¦ ;(2) strengthening the knowledge base through research and development and the transfer of technology; (3) raising standards of living through the creation of wealth, encouraging local industry and providing consumer goods; and (4) enhancing the quality of life by assisting programs that raise standards in health, housing, nutrition, and education. Given that a transnational corporation is actually able to produce these benefits in Third World nations, they are indeed meeting demands of social responsibility. However, Kruckeberg notes that many corporations have encountered criticism relating to graft and corruption issues, consumer issues, environmental/human safety issues, and political/humanitarian issues. For example, Nestle was embroiled in a controversy surrounding their marketing practices in the Third World of breast milk substitutes. Nestle responded effectively and in a socially responsible manner in 1981 by endorsing the World Health Organization's Code of Marketing for Breast Milk Substitutes the day the measure was enacted and assembled experts to monitor the company's compliance with the Code. Kruckeberg suggests that a code of ethics could be developed that would be â€Å"capable of guiding behavior which attempts to resolve the inherent moral dilemmas [of the four types of criticism previous described] as well as other dilemmas that have occurred or potentially could occur. Many of the codes currently in existence do not take into account the particular responsibilities of transnational corporations. However, despite weaknesses in ethical codes they serve four valuable functions: (1) providing guidelines for practitioner activities, (2) demonstrating what clients and supervisors should expect from practitioners, (3) providing basis for charges of wrongdoing, and (4) providing defense against charges of wrongdoing. The new code of ethics should be developed under the leadership of professional communicators from multinational companies, but there should be input from all members of the professional public relations associations. Hunt and Tirpok extend Kruckeberg's argument and suggest that the public relations profession needs to establish a universal ethics code. In addition, they suggest an actual framework for the code and provide a strategy for its adoption. Hunt and Tirpok believe that a universal code of ethics ought to apply to all communications professions, uniting public relations and journalism in this sense, but that the code must be adaptable to the needs of the individual professions. While journalism's purpose is most often objectivity, public relations' purpose is often advocacy. In this manner, public relations practitioners share the general nature of their purpose with lawyers. Nonetheless, â€Å"all systems and codes of ethics seem to be rooted in the same fundamental principles and similar values. Their suggestion for an actual code is that it deal with first order concerns, such as â€Å"keeping faith with the public† and â€Å"achieving consensus,† not specific communications situations, since no code could possibly address all these situations. The timetable for developing and adopting the code would take six years. The first stage would be organizing and conducting a conference of academics and representatives of professional organizations with the purpose of drafting the code. In the second phase encompassing two years, a task force would visit the professional organizations with the aim of obtaining suggestions for modification, implementation, and dissemination of the code. The third phase would involve the ratification and implementation of the code. In the final stage, the code would be published and publicized â€Å"to inform target publics about the code and its importance to global communication. † There have been objections to the implementation of a universal ethics code on the grounds that public relations cannot be defined, that anyone can practice public relations due to First Amendment-type rights, and that there are differences within the global community as to what constitutes ethical behavior. Kruckeberg dismisses the criticism of cultural relativists who argue against a universal ethics code citing Asuncion-Lande's recommendation that in distinguishing â€Å"between what is universal and what is distinctive in the ethics of different cultures, ethicists should develop an inventory. This inventory of universal ethics would include â€Å"culturally sanctioned rules of ‘proper' interpersonal conduct, i. e. rules which serve to preserve order and to promote social harmony and unity and which provide stability of human relationships in a rapidly changing world. † Complications in Establishing Effective Ethics Programs A significant problem in the functioning of many corporate ethics programs that undermines its success is that fact that many of these programs are so general and short on specifics, as well as not being equipped to address complex problems. An ideal example is Dow Corning. For years Dow was recognized by business educators as leaders in the area of corporate ethics programs. In 1976, Dow's chairman John S. Ludington established a Business Conduct Committee and Dow also set up ethics training sessions for employees and audits every three years to monitor compliance with the company's ethical guidelines. Nonetheless, there were indications as early as 1977 that the breast implants manufactured by Dow were unsafe. The question raised by Eric Schine was why did the audits monitoring ethical compliance not discover this information. His answer is that â€Å"for the most part, ethics programs aren't designed to deal directly with complex problems. Instead, they are there only to help cultivate an overall environment of proper conduct. † Similar problems occurred at McDonnell Douglas despite their extensive ethics program. In the late 1970's and early 1980's, defense contractors were accused of severe overcharging of the government and some of these contractors were required to compensate the government for the overcharging. In addition, the Iran-contra scandal further tainted the image of defense contractors. In 1980, Sanford McDonnell became Chairman and CEO of McDonnell Douglas and established the company's ethics program because of his conviction that ethics must be woven into the decision process at all steps through all levels of authority. In 1983, McDonnell instigated a study to determine the best course of ethics training for MDC employees. The MDC training program developed a conceptual model for defining ethical decision making. More than 75,000 employees took part in the training seminars. Subsequent to the implementation of the program, the company discovered the following: ethics became an acceptable topic for discussion, Sanford McDonnell's personal participation in the videotape sent a strong message, the case study approach highlighted ethical issues with practical benefits, employees found they did not have to face ethical issues alone, an increased sense of pride developed among the employees, and MDC issued a new policy and procedures manual relative to pricing and contracting with the government. Some of the lessons learned by MDC that could be transferable to other entities include: ethics training should be pragmatic and managerial in nature, strong leadership is needed from the top and implementation must be from the top down, managers must serve as role models, there must be a standardized training procedure and workshops should utilize a participative process. Center and Jackson's main point about the MDC case is that â€Å"a track record of exemplary conduct builds slowly. It requires constant tending. An honorable reputation is both precious and fragile. Opponents or competitors are rearmed by infractions. † In 1988, investigations by the Justice Department, FBI and the Navy, showed evidence of bribery, fraud, and kickbacks in defense contracting. MDC was among the 75 companies named in the investigation. According to Donald K. Wright, voluntary ethics codes are largely ineffective because there is no enforcement mechanism and the codes are only as good as the people who subscribe to them. Much of this criticism is directed at codes of the professional associations. He feels that many codes are just filled with â€Å"meaningless rhetoric. Ultimately, public relations practitioners conduct themselves according to ethical principles because â€Å"they believe in themselves and want others to respect them. † Ethical behavior is not the result of adherence to codes, but rather to the individual practitioner's sense of personal morality. Wright conducted a study to examine the ethical and moral values of practitioners with the major premise of the study being that â€Å"public relations never will be any more ethical than the level of basic ethical morality of the people who are in public relations. He found that the structure of moral values of American practitioners is based on socio-economic morality, religious morality, basic morality, puritanical morality, basic social responsibility morality, and financial morality. Some corporations have addressed the problem cited by Wright, namely that ethics codes are often ineffective when they are not accompanied by enforcement mechanisms. For instance, General Dynamics instituted a comprehensive ethics program aimed at situations involving anti-trust, political contributions, international business, inside information, and corporate resources. Crucial to this program is the possibility of sanctions for infractions, including penalties ranging from warnings to dismissals and criminal proceedings. In terms of professional associations, PRSA developed its first statement of principles in 1950 and its code of professional standards in 1959. Between 1952 and 1985, 168 cases were investigated, with only 10 cases resulting in sanctions. However, the chairman of PRSA's Board of Ethics and Professional Standards, Donald McCammond, claims the â€Å"enforcement procedure gives the Code its teeth, makes it a deterrent in addition to a set of guidelines. Greater Opportunities for Participation in Management Policy Decisions A distinctive benefit of improving social responsibility and ethical decision- making among public relations practitioners is that it will enhance their credibility and increase their opportunities for participating in management policy decisions. Judd conducted a study to test the hypothesis that there is a â€Å"positive relationship between public relations recommending socially responsible actions and public relations participating in policy decisions. One hundred members listed in the 1986-87 Register of the Public Relations Journal were asked, â€Å"Are you aware of situations where public relations has recommended changes in what the organization does or what it produces in order to satisfy the responsibility of the organization to society? † In addition, respondents were asked whether responsibility to the client/employer or to society is more important and were asked a number of questions addressing public relations' credibility in relation to other professions and ways in which credibility could be improved. The study did find a significant relationship at the statistical significance level of . 05 that recommendations of socially responsible actions translated into higher participation in policy decisions. Judd connects these findings to Bernays' opinion that feeling more responsible to society and less motivated by financial rewards marks the development of a profession. This increase in involvement in policy decisions also illustrates public relations strong credibility with management in these cases. Hence, the value of Judd's study is that it shows concern for socially responsible actions among public relations practitioners define public relations as a profession, involve practitioners more intimately in management policy decisions, and improve the credibility of the profession. Judd's study also found that 65% of the respondents viewed responsibility to society as more important than responsibility to the client/employer; in effect, they view themselves as a corporate conscience. In this sense then, public relations practitioners, at least those surveyed, view their ultimate purpose as that of a counselor as opposed to the traditionally assigned role of public relations people as advocates. Grunig fundamentally conceives of public relations as a critical element of the management function. Public relations is â€Å"an essential management function because of its contribution to the long-term, strategic management of the organization. In particular, public relations is involved in the planning process in the sense that it enables communication and building of relationships with publics that support or can divert the mission of the organization. As a result of public relations' capabilities to facilitate communication among publics and its intrinsic role within the management function, it has a unique responsibility to act according to social and ethical considerations. In fact, Grunig asserts that adherence to the requirements of this responsibility is the only way in which public relations can be considered to be an important element of the global communication system. If public relations is practiced according to the principles of strategic management, public responsibility and the two-way symmetrical model, it is an important element of the global communication system — facilitating symmetrical communication that helps to build relationships among organizations and publics and to develop policies that are responsible to those publics. † Ethics Code as a Requirement for Professional Status Thomas H. Bivins asserts that professionalism requires autonomy, but that autonomy comes with the expectation of objectivity. This presents a problem for public relations because not all public relations practitioners serve the role of counselor, many fill the role of advocate. Bivins describes how these two different roles result in the necessity for different ethical guidelines, which involve the degree of responsibility or obligation to the client/employer, degree of objectivity, and degree of autonomy. However, as Judd's study showed, public relations practitioners increasingly view their role as that of counselor, given that they feel more bound to social responsibilities rather than client/employer obligations. This will place a more stringent ethical impetus upon public relations practitioners because the responsibilities of counselors are broader in the sense of having to be concerned with both larger and a greater number of publics. â€Å"Although both the advocate and the counselor must practice within the bounds of the truth, good taste and the law, the counselor must also practice within the moral boundaries of, and with ethical consideration for, all concerned publics. Purpose, therefore, becomes a factor which must be decided upon, to a greater degree, by the counselor. † Bivins stresses that it is the move towards professionalism in the field which has actually led to a concern over ethical principles. Center and Jackson similarly connect ethical concerns with the development of a profession. â€Å"The public relations function has sought to fulfill its aspirations by exerting an ethical and moral force as well as technical skill and, by doing so, developing an identity and a professional discipline of its own. As Winkleman noted, the ethical debate began with Watergate and has gained momentum in the public relations community with the scandals involving Michael Deaver (indicted for perjury) and Anthony Franco (insider trading). Despite the lack of substantial empirical research literature on public relations ethics to date, there appears to be an increased interest in the subject of ethics among educators and researchers. For example, Public Relations Review devoted entire issues to the subject of ethics in 1989 and 1993. Regardless of whether the public relations profession institutes a universal code as some are advocating, empirical evidence has shown that practitioners who base their decision-making on social responsibility and within ethical guidelines, whether personal or structural, will be more likely to be involved in policy decisions. In turn, practitioners will enhance their credibility with management and the public at large. Furthermore, observance of ethical principles demonstrate the mark of a profession.

A Collection of Famous Quotations About Love

A Collection of Famous Quotations About Love What do Victor Hugo, Carl Jung, John Lennon, Louisa May Alcott, and Socrates have in common? The answer is that they have all commented on the ways of love. Saints, philosophers, psychologists, playwrights, and poets have left their  views of love for us to read. From ancient scrolls to classic plays, modern films, and songs, love is a timeless subject. Explore these  famous love quotes. Carl Jung Where love rules, there is no will to power; and where power predominates, there love is lacking. The one is the shadow of the other. Sigmund Freud Love and work are the cornerstones of our humanness. Victor Hugo The greatest happiness of life is the conviction that we are loved. Dante Alighieri He loves but little who can say and count in words, how much he loves. George Bernard Shaw Love is a gross exaggeration of the difference between one person and everybody else. John Barrymore Love is the delightful interval between meeting a beautiful girl and discovering that she looks like a haddock. Sigmund Freud We are never so helplessly unhappy as when we lose love. Lord Alfred Tennyson He that shuts love out, in turn, shall be Shut out from love and on her threshold lie, Howling in outer darkness. Louisa May Alcott Love is a great beautifier. Nat King Cole The greatest thing you ever learn is just to love and be loved in return. William Makepeace Thackeray It is best to love wisely, no doubt; but to love foolishly is better than not to be able to love at all. Socrates The hottest love has the coldest end. Henry Drummond You will find as you look back upon your life that the moments when you have really lived are the moments when you have done things in the spirit of love. John Lennon Love is the flower youve got to let grow. Thomas Moore But theres nothing half so sweet in life As loves young dream. George Moore The hours I spend with you I look upon as sort of a perfumed garden, a dim twilight, and a fountain singing to it. You and you alone make me feel that I am alive. Other men, it is said have seen angels, but I have seen thee and thou art enough. William Shakespeare If love be rough with you, be rough with love. Prick love for pricking you and beat love down. Margaret Atwood The Eskimos had fifty-two names for snow because it was important to them: there ought to be as many for love. Gloria Gaither Line by line, moment by moment, special times are etched into our memories in the permanent ink of everlasting love in our relationships. Nicholas Sparks You are every reason, every  hope, and every dream Ive ever had. Elisabeth Elliot You are loved with an everlasting love. And underneath are the everlasting arms. From the movie Twilight: Breaking Dawn Part 1 No measure of time with you will be long enough. But lets start with forever. If you enjoy reading popular quotes, see  Drake love quotes and Bob Marley quotes.

An Overview of Capitalism Using the Method of Marxism

An Overview of Capitalism Using the Method of Marxism Marxian theories against capitalism Historical materialism Marx’s theory of historical materialism, inspired by Hegel’s phenomenology, stated that both human societies and cultural institutions resulted from economic activity. Unlike Hegel who stated that abstract ideas were the cause of change, however, Marx proposed that material, economic forces, and their relationship with the natural, biological and physical world, were the determining proponents of dialectical change. History rests in the internal contradictions in the system of material production (producing what people need for survival), and other factors that have influenced society, such as geographical movement and growth of population, were not as determinant as the mode of production. Any changes in the material and economic conditions of a society also imply changes in its social relations. Social change, then, resulted from internal conflicts in a society’s economy. The social reality determines human consciousness. The mode of production is composed of two aspects: the productive forces and men’s relations of production. The productive forces include the instruments of production wherewith material values needed for survival, such as food, clothing, shelter, fuel, etc., are produced and the people who use these instruments in the production of material values through their production experience and labor skill. Men’s relations of productions, on the other hand, refer to the relations the people make with each other during production. These may come in the form of cooperation and mutual help, and in domination and subordination. Marx regarded revolutions not as political accidents, but manifestations of the historical progress of societies. Revolutions occur when modes of production â€Å"mature†, or contradict themselves to the point that they eventually collapse. Marx recounts human history in terms of four modes of production. The first mode of production, named asiatic, was considered as primitive communism, It was characterized by a communal ownership of land and essential economic resources. This mode of production was phased out when physically stronger people instituted the concept of private property. The ancient mode of production gave authority to people with physical, political and material strength – the masters while the non-owning class were slaves. Slaves were treated as commodities and made to engage in torturous menial and physical labor. This started a revolution of the slaves against their masters. The feudal mode of production was characterized, again, by two classes: feudal lords and serfs. Lords owned the land, and their job was to lease land and employ agricultural labor in their lands. The serfs worked in the lands and paid taxes in exchange for the lords’ protection. Like in the ancient mode of production, the serfs revolted against the lords. Industrialism grew becaus e of the revolution. Finally, the capitalistic mode of production, and the one Marx was most bothered with, caused the migration from rural to urban areas. There were two working classes as well: the bourgeoisie, who owned most of society’s wealth and means of production, and the proletariats, who rendered service for survival. Marx wanted that the exploitation present since the ancient mode of production would dispel, and so proposed socialism and communism. Socialism is the beginning stage wherein society is classless, while communism is the final stage wherein equality has been thoroughly implemented and private property and ownership are absent. Alienation The Marxist definition of alienation means that man does not experience himself as the acting agent in his grasp of the world, but that the world remains alien to him. The process of alienation is expressed in work and the division of labor, especially due to the emergence of capitalism and private property. Eventually, labor rules over the man and becomes a power independent of its producer. Man’s identity and consciousness of himself and his world becomes marred. â€Å"The object produced by labor, its product, now stands opposed to it as an alien being, as a power independent of the producer. The product of labor is labor which has been embodied in an object and turned into a physical thing; this product is an objectification of labor† Marx seeks the liberation of man from labor that destroys his individuality through his criticism of capitalism. Capitalist production, according to him, transforms the relations of individuals into qualities of things, and exploits its producers like machines through aliented labor. He differentiates proper work and alienated labor as thus: â€Å"Man no longer reproduces himself merely intellectually, as in consciousness, but actively and in a real sense, and he sees his own reflection in a world which he has constructed. While, therefore, alienated labor takes away the object of production from man, it also takes away his species life, his real objectivity as a species-being, and changes his advantage over animals into a disadvantage in so far as his inorganic body, nature, is taken from him. Just as alienated labor transforms free and self-directed activity into a means, so it transforms the species life of man into a means of physical existence. Consciousness, which man has from his species, is transformed through alienation so that species life becomes only a means for him. Alienation also leads to the perversion of moral values, as man is too conscious of economy’s values gain, work, thrift and sobriety to develop virtues. Due to the rising importance of commodities and money, for every new product, the potential for deceit and robbery grows. The alienated man only knows one way of relating himself to the world: through having and consuming it. He becomes more needy for money and possessions, and watches for signs of weaknesses in which he can maximize his gain. Class Consciousness Class consciousness is recognizing that the different interests and conditions of living between the two classes (bourgeois and proletariat) define their relationship with each other. This occurs when there is awareness from the working class that the conditions of labor and living of their class was created by the upper class. Once this happens, the working class becomes the enemy of the upper class. There are six features of class consciousness, although it was not Marx, but Bertell Ollman, who came up with them. The first feature pertains to the subjective and objective identity and interests of membership in a class. â€Å"Subjective† refers to what people think about their class situation, while â€Å"objective† refers to how the classes actually worked as seen in historical development, The second feature is that people must be knowledgeable about how capitalism works, either to benefit or deter them. The third feature pertains to the â€Å"broad outlines of class struggle and where one fits into it†. The fourth feature pertains to the solidarity with other members of the same class, which are exemplified by worker unions and revolts. The fifth feature is a â€Å"rational hostility† towards the opposing class. The last feature pertains to having a â€Å"vision of a more democratic and egalitarian society that is not only possible but is a condition individuals can help bring about.†

Values Scenario 4 Essay Example | Topics and Well Written Essays - 750 words

Values Scenario 4 - Essay Example However, for a true Christian, this should not be the case. The bible should be used like a map to guide people in their way. I try to show how bible principles can be applied for a successful business. I am going to emphasize on twelve principles that that can help a Christian run his business successfully. I will start with diligence. According to the book of proverbs 22:29 the bible says that a man diligent in his business can even stand before kings. In Hebrew, the word diligent can mean fast, quick, skillful or ready. Therefore, when a customer pops in, the business person should be more than ready to serve him or her. Such service cannot be always possible. However, one should try hard to achieve this. in the new testament, Paul wrote to the Christians telling them to not to be slothful in business but instead, business men should be fervent in their work. Laziness should not be tolerated in business (Brott). The other principle is right planning. Proverbs chapter 16 verse 3 says that all a man’s work should be committed to the lord. A new business should work out the general business parameters in terms of site, size and stocks. Committing our works to the lord should help establish thoughts. The third principle is our way of thinking. The word thought should be used to give a description of the inner voices of self-awareness. Having clear and logical thoughts can make our lives easier. The bible says that the strategies of the diligent result in plenty but for the hasty, poverty might be knocking on the door. The meaning of this is that if we do fill our heads with good information we will surely prosper. Wise input contributes to wise output. For instance, in times of recession, many businesses might close since the owners could be inflexible to change. Recessions always result in an opportunity to take up the available directions (Tsague). The other principle is morality. If a business

Shakespeare othello Essay Example | Topics and Well Written Essays - 1250 words

Shakespeare othello - Essay Example He is a manipulator and vicious and desires for the demise of Othello by evoking jealousy in his mind against his wife Desdemona. Othello is a gentleman while Lago is a vicious character who succeeds in destroying the life of Othello and his wife through his malicious nature. Analysis of relationship of Othello with Lago The Othello is the hero of the play and Lago is villain and thus both share a contradicting relationship with each other. The relationship of both is of conflicting nature. The conflict is between two characters who had been warmest friends in the nearest time. Othello being the General and Lago being the trusted officer shared a lovable relationship with one another until the latter desires for promotion in his career and wanted to ruin Othello’s life completely.Until the conflict both were looked upon as individual with excellent ability and amicable character. Othello was known as the â€Å"noble moor† and Lago was his confident with honest character . The change in the attitude of Lago was sudden one and he immediately turned into a selfish man and mortal enemy of Othello. Lago treats Othello as a rival and wants promotion and take over the higher status in military. Othello has a â€Å"free and open mind† and this is utilized by Lago by conveying treacherous story of Desdemona to Othello. Yet Othello says that â€Å"She had eyes and Chose me â€Å".The rivalry rages between Lago and Othello, when the former hears that Cassius the friend of Desdemona had been promoted to lieutenant status which leaves him behind in professional hierarchy. Lago relationship with Othello turns bitter when he realizes that Othello has preferred Cassius for lieutenant role over him. He believes that Othello has disregarded rules of military and friendship, hence is only worth to be his enemy. The Othello had immense trust on Lago and was unaware of the bitterness growing in his mind against him. However, Lago’s start to saw seeds of hatred in the mind of Othello against Desdemona his beloved wife. The relationship verification of Othello and Lagos represents good versus bad. From the beginning of the play Lago is evil to Othello and as the play moves further he reveals his true colors. In the play, the character and intention of Lago remains same evil and Othello remains a puppet in his hand. Primary motive of Othello In the beginning of the play â€Å"Othello†, the central character Othello does not have any unjust motive. However as Lagos poisons his mind, he wishes to kill his wife due to the honor and pride he carried with his personality. He is definitely not much jealous as he is dishonored while hearing the disloyalty carried out by his beloved wife. The motive of honor encouraged him to kill his wife as he cried and enraged as an honored husband. Othello is a black man and he is being considered outcast by his wife’s father who was white .But Othello loved Desdemona deeply and the sexual jealousy brought forward by Lago hurts his ego, love and honor provokes him to kill Cassius and Desdemona. Primary motive of Lago The character Lago from the beginning of the play till the end is evil . He is a person who disregards moral beauty, ethics or nobleness. His primary motive is treacherous and wants to destroy Othello in every way. His eyes are on promotion and destruction of Othello’s. professional as well as personal life. He is wicked and is expert in performing acts

SLP 2 TUX 101 INFORMATION LITERACY AND ACADEMIC INTEGRITY Essay

SLP 2 TUX 101 INFORMATION LITERACY AND ACADEMIC INTEGRITY - Essay Example Unfortunately, owing to the dynamics in the contemporary society where both parents need to work in an effort to support each other in providing the demands of the family, there is limited time that parents spend with their children. Establishment of a balance amid work-family life becomes a difficult undertaking for many parents as most tend to focus on one and in most cases the work side. Caring for children and ensuring that all their demands are met, in most cases becomes the duty of the house helps, baby care centers and teachers (Gottschalg & Meier, 2005). The limited time that parents spent with their children exposes them to stress, and many develop depressive symptoms, which worsen the situation, as these parents increase the gap amid them and their children. Conversely, this is not the case for good parents, who have the capacity to balance their work and family life, and thereby manage to deal with the probable stress that emanates from the same. These parents engage with their children in all aspects, and regardless of being busy at work, they ensure that they learn how their children spent their day and whether they have completed their school work. These parents are always in close contact with teachers; house helps and baby care centers caregivers as they attempt to learn and comprehend the developments that their children are making. Another strategy that good parents adopt in order to eradicate stress and the development of depressive symptoms is by creating time to have fun with their children and spouses. Family outings help relieve stress and strengthen the bond amid parents and children are they interact from a friendly point of view, meaning children managed to express themselves easily, present their concerns and offer comm ents and insights on areas they believe need consideration, either at home or in school (Gottschalg &

Genetic Variation of Taste Receptors

Genetic Variation of Taste Receptors Abstract: The people have different behaviour to choose the food, and there are many factors that affect the food choices. The best significant factor to choose the food is taste. Differences in taste perception of several taste modalities are associated to difference in the taste receptors. Polymorphisms of the genes that encoding these taste receptors may clarify these unpredictability in taste perception. Individual changes in the capability to identify bitter tasting compounds, such as phenylthiocarbamide (PTC) was a well-known example of this variability. This difference divided the people in two groups: tasters and non-tasters, and is because of in part to single nucleotide polymorphisms (SNP) of a bitter taste receptor gene, taste receptor, type 2 (TAS2R) 38. The experiment was designed to determine the PTC phenotype and genotype, the SNP at position 785 is of particular importance in genotyping. DNA was extracted from check cell by using Chelex technique and genotyped by using polymera se chain reaction (PCR) followed by restriction fragments length polymorphism (PCR-RFLP). A 2% of Agarose gel electrophoresed and stained with Ethidium Bromide to imagine the genotype pattern. The class was tasted PTC test paper to compare phenotype and genotype. The total was 108 students the genotype showed 21 taster (+/+), 51 was mild taster (+/-) and 36 was nontaster (-/-). The allele frequency was not statistically significantly differ from European population. Therefore, TAS2R38 genotype is a truer estimation of the extent of the influence of this single gene on taste perception of PTC in a genetically diverse population. Introduction: Taste perception is the most sensitive predictor of how much a food is pleasant and unpleasant. The people are different in the taste perception of sweet, bitter, sour, or salty tastes which could influence the dietary behaviour (2, 3, 4). The variations in the taste perception between the individuals may relate to a variation in the gene taste receptors (2). The gene family of the taste receptors are encoding from TAS1R and TAS2R. The bitter taste receptors are include the TAS2R38 and TAS2R550. While the umami and sweet taste receptors is the TAS1R. The sour taste receptors are the PKDIL3 and PKD2L1. The genetic variation in these receptors may causes to deferential favourites for some types of food. Phenylthiocarbamide (PTC) compounds is the example was more studied in the variation of the sensitivity of taste as the bitterness (2, 5). The TAS2R38 gene is one of the most studied from over twenty-five in bitter taste receptor gene (4).The TAS2R38 gene is responsible for the taste perception of PTC as more bitter and the other related compounds like 6-n-propylthiouracil (PROP) which both contain a group of thiourea (7.8). The variation in the gene TAS2R38 divided the individuals in two groups of thiourea tasters: tasters and non-tasters (4, 5). Phenylthiocarbamide (PTC) The variation in the taste perception of PTC rely on the genetic studies. In 1930s, difference in the ability to taste PTC was first finding by Arthur L. Fox in a laboratory accidental (6). When he was working in the laboratory and transferring PTC powder into a bottle. Some particles of PTC powder flew into the air and his colleague close to him C. R. Noller tasted the particles as bitter but Fox tasted nothing. Fox was make experiment to test a large number of individuals and he found the difference in their ability to taste PTC and he divided the people in two main groups’ tasters and non-tasters (1). Worldwide about 25% of population classified as ‘non-tasters’ and the remaining 75% as ‘tasters’ (1). In addition, Bartoshuk et al, in 1992, discovered that the ‘tasters’ varied in the perception of PTC/PROP in a bi-modal fashion, and they separated them into medium tasters and supertasters. The supertasters were very sensitive to PTC, pe rceiving them as more bitter, while the medium tasters may taste PTC and found it mild bitter. Besides, the spread of super, medium and non-tasters in the general population is roughly 25%, 50% and 25%, respectively (1). The PTC sensitivity believed to be inherited as a simple Mendelian trait with two alleles a dominant trait (T) for taster and recessive trait (t) for non-taster (9). Figure 1: shows the inheritance of PTC trait. PTC genotype TAS2R38 or PTC gene is located on chromosome 7q and consists of a single coding exon 1002 bp long, encoding 333 amino acids, 7-transmembrane domain G-protein-coupled receptor (2, 6). A number of SNPs have been identified within this gene, the three most common SNPs (>1% of the population has variants at a specific DNA sequence, considered an SNP and (4).Also, the PAV/PAV homozygotes are sensitive to PTC more than PAV/AVI heterozygotes while AVI/AVI homozygotes are fewer sensitive (4). The AVI haplotypes in the non-tester differ at 3 SNPs from the PAV haplotypes of the tasters (9). The aim of this practical: To focus on the TAS2R38 genotype and its link with the ability to taste PTC test paper. The SNP at position 785 is of specific concern in genotyping. Comparing the allele frequency detected in the class with those observed in European population subject in group 226 and Sub-Saharan African subject in group 224. Material and Methods: To determine the TAS2R38 (A262V) genotype by using the polymerase chain reaction (PCR) and restriction endonuclease digestion, Fnu4H1 enzyme. The procedure that has been done was as the following: Protocol of DNA Extraction from Cheek Cell (scrape or wash): First week take a 10 ml of water pour into mouth and swirl to release buccal cells and spit back contents into tube. Centrifuge the tube at 3000rpm for 3 minutes, carefully pour off supernatant and retain cell pellet. Added 350Â µl of 5% Chelex mix and then transfer the pelleted buccal cells to new (1.5ml) Eppendorf tube. The 5% Chelex to protects DNA breakdown under a high temperature. Added 4Â µl of proteinase K to the Eppendorf tube that contains buccal cells and 5% Chelex. Incubated the tube containing chelex/cells at 56Â °C for 30 minutes in the heating block, then briefly vortex the tube for 10 seconds after that centrifuge the tube at 3000rpm for 20 seconds. Incubated the tube ( chelex/cells) again in heating block at 98Â °C for 15 minutes, then vortex the tube for 10 seconds, after that centrifuge for 3minutes.Transferred the supernatant that above the chelex containing the buccal cell (DNA template) into the sterile 1.5ml Eppendorf tube and measured the DNA concentration by take 1Â µl of DNA into machine called nanodrop nucleic acid then kept at -20Â °C to preserve the DNA. Protocol of Phenyl Thiocarbanate(PTC) using PCR Reaction: Second week take a 43.5Â µl of master mix was already prepared in the PCR tube and transferred 6.5Â µl of DNA extraction. (Buccal cell DNA).Vortex and spin the tube to make the liquid contents to bottom of the tube. The total PCR tube reaction volume contain 50Â µl of mixtures were placed in the PCR machine and the thermal cycler conditions were: cycle of 94Â °C for 4 minutes. The 40 cycles of 55Â °C for 40 seconds, 72Â °C for 40 seconds and 94Â °C for 40 seconds .Then 1 cycle of 55Â °C for 5 minutes and at 72Â °C for 5 minutes. The sequence of Forward primer was 5’ AACTGGCAGAATAAAGATCTCAATTTAT3’ The sequence of the Reverse primer was 5’ AACACAAACCATCACCCCTATTTT 3’. Restriction Digestion (Fnu4HI): Last week transferred a 20 ÃŽ ¼l of the component mixture (PCR product) to a tube containing 10ÃŽ ¼l of the restriction endonuclease master. The tube was placed in into a 37Â °C heating block for two hours. Electrophoresis of PCR Products: A 30ml of 2% Agarose gel with 0.5Â µl/ml of ethidium bromide was loaded into the gel tank with adjusting the comb, the gel was kept 15 minutes to get stuck. After that the TBE buffer was loaded, covering the surface of the gel and the comb was removed. Take 12Â µl of PCR product undigested and digested into two different tubes added 3Â µl of DNA loading buffer mix and spin. Then, 10ÃŽ ¼l of PCR product/loading buffer was loaded into the well of 2% Agarose gel and 10ÃŽ ¼l of the ladder (100bp) was added in the last well. The gel electrophoresed at 90 volt for 45minutes, negatively charged (-ve) DNA moved toward the anode side (red). Last take gel photograph under UV trans-illumination. Taste tests: The PTC taste test paper was used to observe the capability to identify the bitterness of PTC and its relative with the TAS2R38 genotype. Statistical analysis: The data of the allele frequency for C785 and T785 observed in the class was compared to the allele frequency of European population subjects in group 226 and Sub-Saharan African subject in group 224 by using the Chi square test. The Chi square test was also used to investigate the association between the TAS2R38 genotype and phenotype. All statistical analyses were performed with Minitab data analysis software. References Feeney E. The impact of bitter perception and genotypic variation of TAS2R38 on food choice. Nutrition Bulletin. 2011; 36(1):20-33. Wooding S, Kim U, Bamshad M, Larsen J, Jorde L, Drayna D. Natural Selection and Molecular Evolution in PTC, a Bitter-Taste Receptor Gene. The American Journal of Human Genetics. 2004; 74(4):637-646. Chaudhari N, Roper S. The cell biology of taste. The Journal of Cell Biology. 2010; 191(2):429-429. Feeney E, OBrien S, Scannell A, Markey A, Gibney E. Genetic variation in taste perception: does it have a role in healthy eating? Proc Nutr Soc. 2010; 70(01):135-143. Lalueza-Fox C, Gigli E, de la Rasilla M, Fortea J, Rosas A. Bitter taste perception in Neanderthals through the analysis of the TAS2R38 gene. Biology Letters. 2009; 5(6):809-811. Kim U, Drayna D. Genetics of individual differences in bitter taste perception: lessons from the PTC gene. Clinical Genetics. 2004; 67(4):275-280. Dotson C, Shaw H, Mitchell B, Munger S, Steinle N. Variation in the gene TAS2R38 is associated with the eating behavior disinhibition in Old Order Amish women. Appetite. 2010; 54(1):93-99. Duffy V, Davidson A, Kidd J, Kidd K, Speed W, Pakstis A et al. Bitter Receptor Gene (TAS2R38), 6-n-Propylthiouracil (PROP) Bitterness and Alcohol Intake. Alcoholism: Clinical Experimental Research. 2004; 28(11):1629-1637. Merritt R, Bierwert L, Slatko B, Weiner M, Ingram J, Sciarra K et al. Tasting Phenylthiocarbamide (PTC): A New Integrative Genetics Lab with an Old Flavor. The American Biology Teacher. 2008; 70(5):e23-e28. Appendix